Joe090611

From Cbcb-private
Jump to: navigation, search

Tuesday, September 6, 2011

  • Viral miRNA
  • RNA-Seq
    • Blast on ACCGTATGTCCCTCGGTCCGT -> miR160.fwd
    • ./samtools view -bS -o SRR018346.bam SRR018346.sorted.bam
    • ./samtools sort SRR018346.bam SRR018346.sorted
  • ToDo
    • Viral miRNA
      • By Virus, By miRNA, by Pathway, analyze unique genes distribution comparing significant pathways to non
    • RNA-Seq
      • Blast on ACCGTATGTCCCTCGGTCCGT -> miR160.fwd analyze again
    • Other
      • Re-write methods section for Jay