Joe090811

From Cbcb-private
Jump to: navigation, search

Thursday, September 8, 2011

  • RNA-Seq
    • miR160 from http://www.mirbase.org/search.shtml
    • >ath-MIR160a MI0000190
    • GUAUGCCUGGCUCCCUGUAUGCCAUAUGCUGAGCCCAUCGAGUAUCGAUGACCUCCGUGGAUGGCGUAUGAGGAGCCAUGCAUAU
    • blasting this finds one sequence starting at Chrom2:16340279
    • > miR160
    • ugccuggcucccuguaugcca
    • blastN
    • miR156a
    • >ath-MIR156a MI0000178
    • CAAGAGAAACGCAAAGAAACUGACAGAAGAGAGUGAGCACACAAAGGCAAUUUGCAUAUCAUUGCACUUGCUUCUCUUGCGUGCUCACUGCUCUUUCUGUCAGAUUCCGGUGCUGAUCUCUUU
    • blasting >miR156a finds two sequences Chrom2:10676573 and Chrom4:15415529
    • ugacagaagagagugagcac
  • Viral miRNA
    • Rad helped me write a script to do the Wilcoxon test on all the pathways per virus per miRNA
      • C:\Users\jcarl\Desktop\Projects\RNA-seq\Pvale.R
  • ToDo
    • Viral miRNA
      • By Virus, By miRNA, by Pathway, analyze unique genes distribution comparing significant pathways to non