Cbcb - User contributions [en]

User:Dpuiu

2011-12-27T15:34:40Z

Dpuiu: /* Other */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]



= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]

User:Dpuiu

2011-12-27T15:33:49Z

Dpuiu: /* Other */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]



= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]

User:Dpuiu

2011-12-27T15:33:03Z

Dpuiu: /* Test data sets */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]



= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]

User:Dpuiu

2011-12-27T15:32:39Z

Dpuiu: /* CBCB software */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]



= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]


= Test data sets =

'''Sanger (1)'''
* 23,536 reads ; 11,652 mates; 1 lib : 4.5K mean; 7X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G878A1.frg

'''Sanger (2)'''
* 100,781 reads ; 50,008 mates; 24 libs : 4.5K & 10K means; 16X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G*frg

'''Solexa unpaired'''
* 2,659,250 36bp reads
* Location: /fs/szdata/Solexa/Streptococcus_suis/suisp17/strip3.fna

'''Solexa paired (1)'''
* 142,858 35bp reads;
* assemble into one 99,995 ctg/scaff by velvet
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.fa

'''Solexa paired (2)'''
* 92,143 35bp reads;
* assemble into 1 scaff by velvetp.sh (velveth -shortPaired)
* assemble into 5 contigs by velvet.sh (velveth)
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.subset.fa

'''Solexa & 454'''
* [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP001087 E coli Whole Genome Sequencing on 454 and Illumina]
* Location /fs/szattic-asmg4/dpuiu/Ecoli

User:Dpuiu

2011-12-27T15:32:15Z

Dpuiu: /* Other */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]



= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]


= CBCB software =
* Link
https://wiki.umiacs.umd.edu/cbcb/index.php/Communal_Software#Core_Software
* Locations
/fs/szdevel/core-cbcb-software
/fs/sz-user-supported
* Change group
$ groups
dpuiu cbcb-staff cbcb cbcbwww

$ newgroup cbcb-staff
# creates a new shell;
$ ^D
* After install ...
find /fs/szdevel/core-cbcb-software | xargs chgrp cbcb-staff
find /fs/szdevel/core-cbcb-software | xargs chmod o-w

= Test data sets =

'''Sanger (1)'''
* 23,536 reads ; 11,652 mates; 1 lib : 4.5K mean; 7X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G878A1.frg

'''Sanger (2)'''
* 100,781 reads ; 50,008 mates; 24 libs : 4.5K & 10K means; 16X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G*frg

'''Solexa unpaired'''
* 2,659,250 36bp reads
* Location: /fs/szdata/Solexa/Streptococcus_suis/suisp17/strip3.fna

'''Solexa paired (1)'''
* 142,858 35bp reads;
* assemble into one 99,995 ctg/scaff by velvet
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.fa

'''Solexa paired (2)'''
* 92,143 35bp reads;
* assemble into 1 scaff by velvetp.sh (velveth -shortPaired)
* assemble into 5 contigs by velvet.sh (velveth)
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.subset.fa

'''Solexa & 454'''
* [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP001087 E coli Whole Genome Sequencing on 454 and Illumina]
* Location /fs/szattic-asmg4/dpuiu/Ecoli

User:Dpuiu

2011-12-27T15:31:03Z

Dpuiu: /* Projects */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]



= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]
* [[dpuiu_definitions|Definitions]]
* [[dpuiu_meeting_notes|Meeting notes]]
* [[dpuiu_articles|My articles]]
* [[dpuiu_CS|CS]] ; [[dpuiu_Perl|Perl]] ; [[dpuiu_C|C]] ; [[dpuiu_Linux|Linux]] ; [[dpuiu_DOS|DOS]] ; [[douiu_wiki|wiki]] ; [[dpuiu_thunderbird|thunderbird]]
* [[Pop_group_meeting|Pop group meeting]] (Monday 's 3pm)
* [[dpuiu_snp|Snp calling]]
* [[dpuiu_todo|ToDo]]

* [[dpuiu_JHU|JHU]]

= CBCB software =
* Link
https://wiki.umiacs.umd.edu/cbcb/index.php/Communal_Software#Core_Software
* Locations
/fs/szdevel/core-cbcb-software
/fs/sz-user-supported
* Change group
$ groups
dpuiu cbcb-staff cbcb cbcbwww

$ newgroup cbcb-staff
# creates a new shell;
$ ^D
* After install ...
find /fs/szdevel/core-cbcb-software | xargs chgrp cbcb-staff
find /fs/szdevel/core-cbcb-software | xargs chmod o-w

= Test data sets =

'''Sanger (1)'''
* 23,536 reads ; 11,652 mates; 1 lib : 4.5K mean; 7X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G878A1.frg

'''Sanger (2)'''
* 100,781 reads ; 50,008 mates; 24 libs : 4.5K & 10K means; 16X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G*frg

'''Solexa unpaired'''
* 2,659,250 36bp reads
* Location: /fs/szdata/Solexa/Streptococcus_suis/suisp17/strip3.fna

'''Solexa paired (1)'''
* 142,858 35bp reads;
* assemble into one 99,995 ctg/scaff by velvet
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.fa

'''Solexa paired (2)'''
* 92,143 35bp reads;
* assemble into 1 scaff by velvetp.sh (velveth -shortPaired)
* assemble into 5 contigs by velvet.sh (velveth)
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.subset.fa

'''Solexa & 454'''
* [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP001087 E coli Whole Genome Sequencing on 454 and Illumina]
* Location /fs/szattic-asmg4/dpuiu/Ecoli

User:Dpuiu

2011-12-27T15:30:18Z

Dpuiu: /* Links */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]

'''Other genomes'''
* [[Bumblebee|Bombus impatiens]]
* [[Brugia_malayi|Brugia malayi]]
* [[Bos_taurus|Bos taurus]] , [[Bos_taurus_redo|Bos taurus redo]] , [[Bos_taurus_3.0|Bos taurus 3.0]]
* [[dpuiu_cat|Cat]]
* [[Coffee_bacs|Coffee BACs]]
* [[Culex_pipiens_symbiont|Culex pipiens wolbachia symbiont]]
* [[Culex_pipiens_mitochondrion|Culex pipiens wolbachia mitochondrion]]
* [[Helicobacter_pylori|Helicobacter pylori]]
* [[Homo_sapiens|Homo sapiens]]
* [[Kalanchoe|Kalanchoe]]
* [[Megachile_rotundata|Megachile rotundata]]
* [[Methanobrevibacter_smithii|Methanobrevibacter smithii]]
* [[Pine_tree|Pine tree]]
* [[Pseudomonas_aeruginosa|Pseudomonas aeruginosa]]
* [[Pseudodomonas_syringae|Pseudomonas syringae]]
* [[Sea_urchin|Sea urchin]]
* [[Turkey|Turkey]]
* [[Xanthomonas_oryzae|Xanthomonas oryzae]] XOO
* [[Xanthomonas_campestris_pv_raphani|Xanthomonas campestris pv. raphani]] XCR
* [[Strawberry|Strawberry]]

* [[Ecoli_germany|Ecoli Germany]]

= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]
* [[dpuiu_definitions|Definitions]]
* [[dpuiu_meeting_notes|Meeting notes]]
* [[dpuiu_articles|My articles]]
* [[dpuiu_CS|CS]] ; [[dpuiu_Perl|Perl]] ; [[dpuiu_C|C]] ; [[dpuiu_Linux|Linux]] ; [[dpuiu_DOS|DOS]] ; [[douiu_wiki|wiki]] ; [[dpuiu_thunderbird|thunderbird]]
* [[Pop_group_meeting|Pop group meeting]] (Monday 's 3pm)
* [[dpuiu_snp|Snp calling]]
* [[dpuiu_todo|ToDo]]

* [[dpuiu_JHU|JHU]]

= CBCB software =
* Link
https://wiki.umiacs.umd.edu/cbcb/index.php/Communal_Software#Core_Software
* Locations
/fs/szdevel/core-cbcb-software
/fs/sz-user-supported
* Change group
$ groups
dpuiu cbcb-staff cbcb cbcbwww

$ newgroup cbcb-staff
# creates a new shell;
$ ^D
* After install ...
find /fs/szdevel/core-cbcb-software | xargs chgrp cbcb-staff
find /fs/szdevel/core-cbcb-software | xargs chmod o-w

= Test data sets =

'''Sanger (1)'''
* 23,536 reads ; 11,652 mates; 1 lib : 4.5K mean; 7X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G878A1.frg

'''Sanger (2)'''
* 100,781 reads ; 50,008 mates; 24 libs : 4.5K & 10K means; 16X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G*frg

'''Solexa unpaired'''
* 2,659,250 36bp reads
* Location: /fs/szdata/Solexa/Streptococcus_suis/suisp17/strip3.fna

'''Solexa paired (1)'''
* 142,858 35bp reads;
* assemble into one 99,995 ctg/scaff by velvet
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.fa

'''Solexa paired (2)'''
* 92,143 35bp reads;
* assemble into 1 scaff by velvetp.sh (velveth -shortPaired)
* assemble into 5 contigs by velvet.sh (velveth)
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.subset.fa

'''Solexa & 454'''
* [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP001087 E coli Whole Genome Sequencing on 454 and Illumina]
* Location /fs/szattic-asmg4/dpuiu/Ecoli

User:Dpuiu

2011-12-27T15:29:44Z

Dpuiu: /* Bookmarks */

Daniela Puiu's page

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]
* [https://wiki.umiacs.umd.edu/cbcb-private/index.php/Main_Page CBCB]
** NCBI complete genomes: /fs/szdata//ncbi/genomes/Bacteria/ (*.fna)
** www -> /fs/www-cbcb/htdocs/
** Personal web site http://www.cbcb.umd.edu/~dpuiu -> /fs/www/users/dpuiu/
** Personal ftp site ftp://ftp.cbcb.umd.edu/pub/data/dpuiu -> /fs/ftp-cbcb/pub/data/dpuiu/

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]

'''Other genomes'''
* [[Bumblebee|Bombus impatiens]]
* [[Brugia_malayi|Brugia malayi]]
* [[Bos_taurus|Bos taurus]] , [[Bos_taurus_redo|Bos taurus redo]] , [[Bos_taurus_3.0|Bos taurus 3.0]]
* [[dpuiu_cat|Cat]]
* [[Coffee_bacs|Coffee BACs]]
* [[Culex_pipiens_symbiont|Culex pipiens wolbachia symbiont]]
* [[Culex_pipiens_mitochondrion|Culex pipiens wolbachia mitochondrion]]
* [[Helicobacter_pylori|Helicobacter pylori]]
* [[Homo_sapiens|Homo sapiens]]
* [[Kalanchoe|Kalanchoe]]
* [[Megachile_rotundata|Megachile rotundata]]
* [[Methanobrevibacter_smithii|Methanobrevibacter smithii]]
* [[Pine_tree|Pine tree]]
* [[Pseudomonas_aeruginosa|Pseudomonas aeruginosa]]
* [[Pseudodomonas_syringae|Pseudomonas syringae]]
* [[Sea_urchin|Sea urchin]]
* [[Turkey|Turkey]]
* [[Xanthomonas_oryzae|Xanthomonas oryzae]] XOO
* [[Xanthomonas_campestris_pv_raphani|Xanthomonas campestris pv. raphani]] XCR
* [[Strawberry|Strawberry]]

* [[Ecoli_germany|Ecoli Germany]]

= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]
* [[dpuiu_definitions|Definitions]]
* [[dpuiu_meeting_notes|Meeting notes]]
* [[dpuiu_articles|My articles]]
* [[dpuiu_CS|CS]] ; [[dpuiu_Perl|Perl]] ; [[dpuiu_C|C]] ; [[dpuiu_Linux|Linux]] ; [[dpuiu_DOS|DOS]] ; [[douiu_wiki|wiki]] ; [[dpuiu_thunderbird|thunderbird]]
* [[Pop_group_meeting|Pop group meeting]] (Monday 's 3pm)
* [[dpuiu_snp|Snp calling]]
* [[dpuiu_todo|ToDo]]

* [[dpuiu_JHU|JHU]]

= CBCB software =
* Link
https://wiki.umiacs.umd.edu/cbcb/index.php/Communal_Software#Core_Software
* Locations
/fs/szdevel/core-cbcb-software
/fs/sz-user-supported
* Change group
$ groups
dpuiu cbcb-staff cbcb cbcbwww

$ newgroup cbcb-staff
# creates a new shell;
$ ^D
* After install ...
find /fs/szdevel/core-cbcb-software | xargs chgrp cbcb-staff
find /fs/szdevel/core-cbcb-software | xargs chmod o-w

= Test data sets =

'''Sanger (1)'''
* 23,536 reads ; 11,652 mates; 1 lib : 4.5K mean; 7X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G878A1.frg

'''Sanger (2)'''
* 100,781 reads ; 50,008 mates; 24 libs : 4.5K & 10K means; 16X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G*frg

'''Solexa unpaired'''
* 2,659,250 36bp reads
* Location: /fs/szdata/Solexa/Streptococcus_suis/suisp17/strip3.fna

'''Solexa paired (1)'''
* 142,858 35bp reads;
* assemble into one 99,995 ctg/scaff by velvet
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.fa

'''Solexa paired (2)'''
* 92,143 35bp reads;
* assemble into 1 scaff by velvetp.sh (velveth -shortPaired)
* assemble into 5 contigs by velvet.sh (velveth)
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.subset.fa

'''Solexa & 454'''
* [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP001087 E coli Whole Genome Sequencing on 454 and Illumina]
* Location /fs/szattic-asmg4/dpuiu/Ecoli

User:Dpuiu

2011-12-27T15:29:11Z

Dpuiu: /* Bookmarks */

Daniela Puiu's page

= Bookmarks =
[[dpuiu_Perl|Perl]] ;
[[dpuiu_C|C]] ;
[[dpuiu_Linux|Linux]];
[[dpuiu_Windows|Windows]];
[[dpuiu_R|R]];
[http://www.bioperl.org/wiki/HOWTOs BioPerl HOWTOs];

= NCBI =

* [http://www.ncbi.nlm.nih.gov/ NCBI] ; [http://www.ncbi.nlm.nih.gov/Traces/assembly/assmbrowser.cgi?cmd=browse&f=&m=main&s=browse AA] ; [http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi?PAGE=Nucleotides&PROGRAM=blastn&MEGABLAST=on&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on BLAST] ; [http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi Microbial_Genomes] ; [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi? SRA] [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/ SRA_FTP] ; [http://www.ncbi.nlm.nih.gov/Traces/trace.cgi? TA] ; [ftp://ftp.ncbi.nih.gov/pub/TraceDB/ TA_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/ Genomes_FTP] ; [ftp://ftp.ncbi.nih.gov/genomes/Bacteria Bacterial Genomes FTP] ; [http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/wwwcmt.cgi Taxonomy CommonTree]
* [http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid=2&type=0&name=Complete%20Bacteria Complete Bacteria]

= Links =

* [http://www.hgsc.bcm.tmc.edu/ Baylor]
* [http://www.embl.org/ EMBL]
* [http://emboss.sourceforge.net/apps/#Overview EMBOSS]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=search&term=homo%20sapiens Homo Sapiens Genome Projects]
* [http://genome.jgi-psf.org/mic_home.html JGI Microbial Genomes]
* [http://www.genomesonline.org/ JGI Genomes Online (GOLD)]
* [http://img.jgi.doe.gov/cgi-bin/pub/main.cgi JGI Integrated Microbial Genomes (IMG)]
* [http://www.sanger.ac.uk/ Sanger]
* [http://www.sanger.ac.uk/Projects/Microbes/ Sanger Microbial Genomes]
* [https://wiki.umiacs.umd.edu/cbcb-private/index.php/Main_Page CBCB]
** NCBI complete genomes: /fs/szdata//ncbi/genomes/Bacteria/ (*.fna)
** www -> /fs/www-cbcb/htdocs/
** Personal web site http://www.cbcb.umd.edu/~dpuiu -> /fs/www/users/dpuiu/
** Personal ftp site ftp://ftp.cbcb.umd.edu/pub/data/dpuiu -> /fs/ftp-cbcb/pub/data/dpuiu/

* [http://www.thearkdb.org/arkdb/index.jsp ARKDB] genetic maps - cow, chicken ...

= Projects =

'''DHS genomes'''
* [[Bioterrorism|Bioterrorism]]
* [[Bacillus_anthracis|Bacillus anthracis]]
* [[Burkholderia_mallei|Burkholderia mallei]]
* [[Burkholderia_pseudomallei|Burkholderia pseudomallei]]
* [[Clostridium_botulinum|Clostridium botulinum]] (Hall strain A str. ATCC 3502) ; uploaded to Insignia ; (other) ; some uploaded to Insignia
* [[Clostridium_perfringens|Clostridium perfringens]] ; some uploaded to Insignia
* [[Cryptosporidium_hominis|Cryptosporidium hominis]] (test)
* [[Francisella_tularensis_holarctica_OSU18|Francisella tularensis OSU18]] in Insignia
* [[Francisella_tularensis|Francisella tularensis]] some uploaded to Insignia
* [[Salmonella|Salmonella]] (Washington Univ in St Louis)
* [[Yersinia_enterocolitica|Yersinia enterocolitica]]
* [[Yersinia_pestis|Yersinia pestis]]

'''Other genomes'''
* [[Bumblebee|Bombus impatiens]]
* [[Brugia_malayi|Brugia malayi]]
* [[Bos_taurus|Bos taurus]] , [[Bos_taurus_redo|Bos taurus redo]] , [[Bos_taurus_3.0|Bos taurus 3.0]]
* [[dpuiu_cat|Cat]]
* [[Coffee_bacs|Coffee BACs]]
* [[Culex_pipiens_symbiont|Culex pipiens wolbachia symbiont]]
* [[Culex_pipiens_mitochondrion|Culex pipiens wolbachia mitochondrion]]
* [[Helicobacter_pylori|Helicobacter pylori]]
* [[Homo_sapiens|Homo sapiens]]
* [[Kalanchoe|Kalanchoe]]
* [[Megachile_rotundata|Megachile rotundata]]
* [[Methanobrevibacter_smithii|Methanobrevibacter smithii]]
* [[Pine_tree|Pine tree]]
* [[Pseudomonas_aeruginosa|Pseudomonas aeruginosa]]
* [[Pseudodomonas_syringae|Pseudomonas syringae]]
* [[Sea_urchin|Sea urchin]]
* [[Turkey|Turkey]]
* [[Xanthomonas_oryzae|Xanthomonas oryzae]] XOO
* [[Xanthomonas_campestris_pv_raphani|Xanthomonas campestris pv. raphani]] XCR
* [[Strawberry|Strawberry]]

* [[Ecoli_germany|Ecoli Germany]]

= Other =
* [[Trace_formatting|Sequencing]]
* [[dpuiu_alignment|Alignment]] *
* [[dpuiu_CA|CA]] ; [[Assembly_merge|Assembly]]
* [[dpuiu_Assemblathon|Assemblathon]]
* [[dpuiu_HTS|HTS]]
* [[Comparative_assemblies|Comparative assemblies]]
* [[Metagenoms|Metagenomics]]
* [[NCBI_submission|NCBI submission]]
* [[Repeat_search|Repeat search]]
* [[Vector_trimming|Vector trimming]]
* [[Data_formats|Data formats]]
* [[dpuiu_definitions|Definitions]]
* [[dpuiu_meeting_notes|Meeting notes]]
* [[dpuiu_articles|My articles]]
* [[dpuiu_CS|CS]] ; [[dpuiu_Perl|Perl]] ; [[dpuiu_C|C]] ; [[dpuiu_Linux|Linux]] ; [[dpuiu_DOS|DOS]] ; [[douiu_wiki|wiki]] ; [[dpuiu_thunderbird|thunderbird]]
* [[Pop_group_meeting|Pop group meeting]] (Monday 's 3pm)
* [[dpuiu_snp|Snp calling]]
* [[dpuiu_todo|ToDo]]

* [[dpuiu_JHU|JHU]]

= CBCB software =
* Link
https://wiki.umiacs.umd.edu/cbcb/index.php/Communal_Software#Core_Software
* Locations
/fs/szdevel/core-cbcb-software
/fs/sz-user-supported
* Change group
$ groups
dpuiu cbcb-staff cbcb cbcbwww

$ newgroup cbcb-staff
# creates a new shell;
$ ^D
* After install ...
find /fs/szdevel/core-cbcb-software | xargs chgrp cbcb-staff
find /fs/szdevel/core-cbcb-software | xargs chmod o-w

= Test data sets =

'''Sanger (1)'''
* 23,536 reads ; 11,652 mates; 1 lib : 4.5K mean; 7X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G878A1.frg

'''Sanger (2)'''
* 100,781 reads ; 50,008 mates; 24 libs : 4.5K & 10K means; 16X cvg
* Location: /fs/szasmg/Bacteria/F_tularensis/TA_FTP/libs/G*frg

'''Solexa unpaired'''
* 2,659,250 36bp reads
* Location: /fs/szdata/Solexa/Streptococcus_suis/suisp17/strip3.fna

'''Solexa paired (1)'''
* 142,858 35bp reads;
* assemble into one 99,995 ctg/scaff by velvet
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.fa

'''Solexa paired (2)'''
* 92,143 35bp reads;
* assemble into 1 scaff by velvetp.sh (velveth -shortPaired)
* assemble into 5 contigs by velvet.sh (velveth)
* Location /nfshomes/dpuiu/szdevel/velvet/data/test_reads.subset.fa

'''Solexa & 454'''
* [http://www.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP001087 E coli Whole Genome Sequencing on 454 and Illumina]
* Location /fs/szattic-asmg4/dpuiu/Ecoli

File:GAGE.summary200.txt

2011-08-26T16:50:06Z

Dpuiu:

Dpuiu Linux

2011-08-12T13:08:00Z

Dpuiu: /* Audio/Video manipulation */

= Version Control =
== Sourceforge ==

shell server: shell.sourceforge.net
CVS server: PROJECTNAME.cvs.sourceforge.net
Subversion server: PROJECTNAME.svn.sourceforge.net

Authentication:
* [http://alexandria.wiki.sourceforge.net/SSH+Key+Generation KeyGen]
* Generate the enw key:
sh-keygen -t dsa -C dxpuiu@shell.sf.net
cat /nfshomes/dpuiu/.ssh/id_dsa.pub >> /nfshomes/dpuiu/.ssh/authorized_keys
* Upload key to the Sourceforge server ("Account Maintenance" site)

== Patching ==
diff file.old file.new > file.diff
patch file.old file.patch

== CVS ==

* Local CVS
echo $CVSROOT
/fs/szdevel/src/cvsroot

/fs/szdevel/src/cvsroot/users/dpuiu/

* Checkout
cvs -z3 -d:ext:dxpuiu@amos.cvs.sourceforge.net:/cvsroot/amos co -P AMOS

* Add a new file
cd src/Utils
cp ~/bin/file .

cvs add file
cvs ci

* Add a new dir
cd src/Utils
cp -R ~/bin/dir .

cvs add dir
cvs ci

cd dir
cvs add *
cvs ci

* Update files
cd src/Utils

cvs update

* Check status
cvs status -v | grep Status:

* Tagging a file
cvs tag file.tag file

* Downloading a tagged file
cvs co -r file.tag file

* Options
-l : Local; run only in current working directory, rather than recursing through subdirectories.
-R: Recursive (default)
-m message

* Keep track of the version in the code :
Add following line: my $VERSION = '$Revision: 1.0 $ ';
Revision gets automatically incremented when "cvs ci"; no need to "cvs update"

* View file
http://amos.cvs.sourceforge.net/viewvc/*checkout*/amos/AMOS/src/Utils/seq2amos.pl
* View all files
http://amos.cvs.sourceforge.net/viewvc/amos/

== Yum ==
yum command [options]

* Examples:
yum -y list installed # list installed packages
yum -y list installed | grep flash # check if flash is installed
sudo yum remove flash-plugin.i386 # remove flash
sudo yum -y install flashplayer-square-plugin.x86_64 # install flashplayer-square

== Git ==

* yum install git-core

= Build =
* [http://www.gnu.org/software/autoconf/ autoconf] extensible package of M4 macros that produce shell scripts to automatically configure software source code packages
* [http://www.gnu.org/software/m4/m4.html m4] [http://www.gnu.org/software/m4/manual/m4.pdf man] implementation of the traditional Unix macro processor
* [http://www.gnu.org/software/libtool/libtool.html libtool] generic library support script. Libtool hides the complexity of using shared libraries behind a consistent, portable interface.
* [http://developer.gnome.org/doc/GGAD/build-app.html Application Build]

* Example: copy executables to /fs/szdevel/dpuiu/; libs to ...
./configure --prefix=/fs/szdevel/dpuiu/ --libdir=/fs/szdevel/dpuiu/lib > configure.log
make > make.log
make install > make.install.log

* Example: explicit compiler location
./configure CC=/usr/bin/gcc CXX=/usr/bin/g++

* Example: build for debug
./configure CFLAGS="-g -pg" CXXFLAGS="-g -pg"
...

= Redirect =

* tcsh : STDOUT & STDERR separately
(command >stdout_file ) >&stderr_file

= Config =
* [http://en.wikipedia.org/wiki/Gconf-editor gconf-editor]

= Commands =
* ftp
ftp - i : turns interactive mode off
> prompt : turns interactive mode off
* diff
diff -rq dir1 dir2 : recursively compares 2 directories
* sort by multiple columns
# column 2:alpha, 3:nucmeric
cat prefix.posmap | msort -k2 -kn3

cat prefix.sam| msort -k3 -kn4

= Utils =
* [http://en.wikipedia.org/wiki/Coreutils Coreutils]
* [http://en.wikipedia.org/wiki/Binutils Binutils]
strip executable # removes debugging info => executable_new

gcc -pg prefix.cc -o prefix # -pg: profiling flag
./prefix #=> gmon.out
gprof prefix > prefix.out
/nfshomes/dpuiu/szdevel/bin/gprof2dot.py prefix.out > prefix.dot
dot -Tpng -o prefix.png prefix.dot

== Convert profiling to dot format ==
* http://linux.softpedia.com/progDownload/gprof2dot-py-Download-27166.html
* http://jrfonseca.googlecode.com/svn/trunk/gprof2dot/gprof2dot.py

== Syncronize directories ==

* Example: syncronize FASTA files
cd dir1
rsync *fasta ../dir2

= System info =

* [http://pagesperso-orange.fr/sebastien.godard/ Sysstat package]
* Processors
/usr/sbin/./x86info
cat /proc/cpuinfo

* sycamore (8 processor):
cat /proc/cpuinfo | more
vendor_id : AuthenticAMD
cpu family : 15
model : 33
model name : Dual Core AMD Opteron(tm) Processor 875
stepping : 0
cpu MHz : 1793.260
cache size : 1024 KB
physical id : 0
siblings : 2
core id : 0
cpu cores : 2

* walnut (16 processor):
vendor_id : AuthenticAMD
cpu family : 15
model : 65
model name : Dual-Core AMD Opteron(tm) Processor 8220
stepping : 3
cpu MHz : 2792.923
cache size : 1024 KB
physical id : 2
siblings : 2
core id : 0
cpu cores : 2

* ginkgo (32 processor)
vendor_id : AuthenticAMD
cpu family : 16
model : 2
model name : Quad-Core AMD Opteron(tm) Processor 8356
stepping : 3
cpu MHz : 2293.905
cache size : 512 KB
physical id : 1
siblings : 4
core id : 0
cpu cores : 4

* Memory
cat /proc/meminfo
free -mt

= Gnuplot =

Scripts for automatic generation:
* ~/bin/len-draw.pl prefix.len : draws a histogram of chromosome lengths
* ~/bin/map-draw.pl prefix.map : draws a synteny map

Example:
perl ~/bin/len-draw.pl turkey.len | gnuplot ; display turkey.png

= Image manipulation =

* [http://www.imagemagick.org/script/command-line-tools.php ImageMagick]
* Merge:
montage *a.jpg montage.jpg
* Get attributes
identify prefix.jpg

= Audio/Video manipulation =
* [http://www.catswhocode.com/blog/19-ffmpeg-commands-for-all-needs]
* [http://www.ffmpeg.org/index.html FFMpeg]
ffmpeg -i movieSample.avi -ab 256k -vn autioSample.mp3

* Youtube download:
youtube-dl "url"

= Pretty printing =

* enscript
enscript -G -r -B -f "Courier8" -p file.ps file.txt
ps2pdf file.ps file.pdf
lpr file.pdf

= Quick calculations =
* bc
echo 99 \* 8 | bc
echo 99 \< 8 | bc

= Commands =
== alias ==
* With arguments:
alias backup cp -i \!:1 \!:1.`date`

== mkfifo ==
mkfifo fifo
cat fifo &
ls >> fifo

==chgrp ==

* Make all new files craeted under /fs/www-umiacs-users belong to dpuiu
chgrp cbcb /fs/www-umiacs-users/dpuiu
chmod 775 /fs/www-umiacs-users/dpuiu
chmod g+s /fs/www-umiacs-users/dpuiu

== time ==

* Format
Time Memory IO
%Uuser %Ssystem %Eelapsed %PCPU (%Xtext+%Ddata %Mmax)k %Iinputs+%Ooutputs (%Fmajor+%Rminor)pagefaults %Wswaps

%U Total number of CPU-seconds that the process spent in user mode.
%S Total number of CPU-seconds that the process spent in kernel mode.
%E Elapsed real time (in [hours:]minutes:seconds).

%P Percentage of the CPU that this job got, computed as (%U + %S) / %E.

= Articles =
* [http://www.cyberciti.biz/tips/top-linux-monitoring-tools.html Most useful sysadmin tools]

Pine tree

2011-08-11T21:35:41Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 264,547 100 108 123 169 32,435 228.49 0 60,445,493

-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74,820 100 105 125 390 31,673 320.75 0 23,998,536
cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD
cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439
mito 83 105 448 1730 6851 26,364 4315.20 0 358,162
other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184
ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%)
reads 82,283,738

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7,859* 100 113 139 284 43,079* 331.49 . 2,605,184
cChloroplast 20 111 193 436 6140 43,079 5951.05 0 119,021 # MUCH BETTER
cBAC 5,117 100 114 141 320 13,733 334.94 0 1,713,870
mito 8 101 134 685 1396 2,166 749.75 0 5,998 # VERY BAD
other 2,714 100 111 133 226 7,353 282.35 0 766,295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

* About 8.5% of the reads contain a high copy kmer . they don't get assembles
AAAGAGTGTAGATCTCGGTGGT
AACTCCAGTCACTTAGGCATCT
AAGACGGCATACGAGATGCCTA
AAGAGTGTAGATCTCGGTGGTC
AAGATCGGAAGAGCGTCGTGTA
AAGCAGAAGACGGCATACGAGA
AAGTGACTGGAGTTCAGACGTG
ACACGTCTGAACTCCAGTCACT
ACCGAGATCTACACTCTTTCCC
ACGAGATGCCTAAGTGACTGGA
ACGGCATACGAGATGCCTAAGT
ACGGCGACCACCGAGATCTACA
ACGTCTGAACTCCAGTCACTTA
ACTCCAGTCACTTAGGCATCTC
AGAAGACGGCATACGAGATGCC
AGACGGCATACGAGATGCCTAA
AGACGTGTGCTCTTCCGATCTA
AGAGTGTAGATCTCGGTGGTCG
AGATCGGAAGAGCACACGTCTG
AGATCGGAAGAGCGTCGTGTAG

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
ctg 802,463 32 33 39 63 73,415 91.13 0 73,131,767 37,254,577
edge 1,013,801 1 2 7 32 30,919 48.85 0 49,525,815
reads 47,092,950 7,440,686,100

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
cE_coli 149 100 325 6612 41908 291,000 30160.59 0 4,493,928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24,932 1875.86 0 108,800
cBAC 12,294 100 141 785 4204 45,781 3513.34 0 43,192,987
other 7953 100 113 171 599 41,416 619.60 0 4,927,664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
ctg 265,450 32 34 50 121 49,599 143.69 0 38,141,459 40,191,864(85%)
edge 530,926 1 3 11 40 41,918 63.06 0 33,477,999
reads 47,092,950 7,440,686,100

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
cE_coli 205 100 252 2244 30571 239,672 21916.78 0 4,492,939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4,679
cChloroplast 31 100 130 322 1363 5,717 986.52 0 30,582
cBAC 15,668 100 133 336 1529 33,075 1559.92 0 24,440,863
other 9,574 100 117 171 522 27,341 542.74 0 5,196,233

Pine tree

2011-08-11T20:25:36Z

Dpuiu: /* SOAPdenovo's */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 264,547 100 108 123 169 32,435 228.49 0 60,445,493

-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74,820 100 105 125 390 31,673 320.75 0 23,998,536
cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD
cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439
mito 83 105 448 1730 6851 26,364 4315.20 0 358,162
other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184
ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%)
reads 82,283,738

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7,859* 100 113 139 284 43,079* 331.49 . 2,605,184
cChloroplast 20 111 193 436 6140 43,079 5951.05 0 119,021 # MUCH BETTER
cBAC 5,117 100 114 141 320 13,733 334.94 0 1,713,870
mito 8 101 134 685 1396 2,166 749.75 0 5,998 # VERY BAD
other 2,714 100 111 133 226 7,353 282.35 0 766,295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
ctg 802,463 32 33 39 63 73,415 91.13 0 73,131,767 37,254,577
edge 1,013,801 1 2 7 32 30,919 48.85 0 49,525,815
reads 47,092,950 7,440,686,100

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
cE_coli 149 100 325 6612 41908 291,000 30160.59 0 4,493,928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24,932 1875.86 0 108,800
cBAC 12,294 100 141 785 4204 45,781 3513.34 0 43,192,987
other 7953 100 113 171 599 41,416 619.60 0 4,927,664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
ctg 265,450 32 34 50 121 49,599 143.69 0 38,141,459 40,191,864(85%)
edge 530,926 1 3 11 40 41,918 63.06 0 33,477,999
reads 47,092,950 7,440,686,100

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
cE_coli 205 100 252 2244 30571 239,672 21916.78 0 4,492,939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4,679
cChloroplast 31 100 130 322 1363 5,717 986.52 0 30,582
cBAC 15,668 100 133 336 1529 33,075 1559.92 0 24,440,863
other 9,574 100 117 171 522 27,341 542.74 0 5,196,233

Pine tree

2011-08-11T18:10:47Z

Dpuiu: /* PineUpload070711 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224,963 100 110 128 343 23,410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74,820 100 105 125 390 31,673 320.75 0 23,998,536
cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD
cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439
mito 83 105 448 1730 6851 26,364 4315.20 0 358,162
other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184
ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%)
reads 82,283,738

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7,859* 100 113 139 284 43,079* 331.49 . 2,605,184
cChloroplast 20 111 193 436 6140 43,079 5951.05 0 119,021 # MUCH BETTER
cBAC 5,117 100 114 141 320 13,733 334.94 0 1,713,870
mito 8 101 134 685 1396 2,166 749.75 0 5,998 # VERY BAD
other 2,714 100 111 133 226 7,353 282.35 0 766,295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
ctg 802,463 32 33 39 63 73,415 91.13 0 73,131,767 37,254,577
edge 1,013,801 1 2 7 32 30,919 48.85 0 49,525,815
reads 47,092,950 7,440,686,100

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
cE_coli 149 100 325 6612 41908 291,000 30160.59 0 4,493,928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24,932 1875.86 0 108,800
cBAC 12,294 100 141 785 4204 45,781 3513.34 0 43,192,987
other 7953 100 113 171 599 41,416 619.60 0 4,927,664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
ctg 265,450 32 34 50 121 49,599 143.69 0 38,141,459 40,191,864(85%)
edge 530,926 1 3 11 40 41,918 63.06 0 33,477,999
reads 47,092,950 7,440,686,100

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
cE_coli 205 100 252 2244 30571 239,672 21916.78 0 4,492,939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4,679
cChloroplast 31 100 130 322 1363 5,717 986.52 0 30,582
cBAC 15,668 100 133 336 1529 33,075 1559.92 0 24,440,863
other 9,574 100 117 171 522 27,341 542.74 0 5,196,233

Pine tree

2011-08-11T17:47:23Z

Dpuiu: /* PineUpload070711 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224,963 100 110 128 343 23,410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74,820 100 105 125 390 31,673 320.75 0 23,998,536
cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD
cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439
mito 83 105 448 1730 6851 26,364 4315.20 0 358,162
other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184
ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%)
reads 82,283,738

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7,859* 100 113 139 284 43,079* 331.49 . 2,605,184
cChloroplast 20 111 193 436 6140 43,079 5951.05 0 119,021 # MUCH BETTER
cBAC 5,117 100 114 141 320 13,733 334.94 0 1,713,870
mito 8 101 134 685 1396 2,166 749.75 0 5,998 # VERY BAD
other 2,714 100 111 133 226 7,353 282.35 0 766,295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
ctg 802,463 32 33 39 63 73,415 91.13 0 73,131,767
edge 1,013,801 1 2 7 32 30,919 48.85 0 49,525,815
reads 47,092,950

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707
cE_coli 149 100 325 6612 41908 291,000 30160.59 0 4,493,928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24,932 1875.86 0 108,800
cBAC 12,294 100 141 785 4204 45,781 3513.34 0 43,192,987
other 7953 100 113 171 599 41,416 619.60 0 4,927,664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
ctg 265,450 32 34 50 121 49,599 143.69 0 38,141,459
edge 530,926 1 3 11 40 41,918 63.06 0 33,477,999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25,482 100 127 262 993 239,672 1339.89 0 34,143,040
cE_coli 205 100 252 2244 30571 239,672 21916.78 0 4,492,939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4,679
cChloroplast 31 100 130 322 1363 5,717 986.52 0 30,582
cBAC 15,668 100 133 336 1529 33,075 1559.92 0 24,440,863
other 9,574 100 117 171 522 27,341 542.74 0 5,196,233

Pine tree

2011-08-11T17:39:56Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224,963 100 110 128 343 23,410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74,820 100 105 125 390 31,673 320.75 0 23,998,536
cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD
cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439
mito 83 105 448 1730 6851 26,364 4315.20 0 358,162
other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184
ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%)
reads 82,283,738

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7,859* 100 113 139 284 43,079* 331.49 . 2,605,184
cChloroplast 20 111 193 436 6140 43,079 5951.05 0 119,021 # MUCH BETTER
cBAC 5,117 100 114 141 320 13,733 334.94 0 1,713,870
mito 8 101 134 685 1396 2,166 749.75 0 5,998 # VERY BAD
other 2,714 100 111 133 226 7,353 282.35 0 766,295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T17:38:32Z

Dpuiu:

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224,963 100 110 128 343 23,410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74,820 100 105 125 390 31,673 320.75 0 23,998,536
cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD
cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439
mito 83 105 448 1730 6851 26,364 4315.20 0 358,162
other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184
ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%)
reads 82,283,738

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T17:33:14Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28934 100 111 136 426 23376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61152 100 121 151 200 30846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74,820 100 105 125 390 31673 320.75 0 23,998,536
ctg 5,755,282 32 32 35 43 7195 41.63 0 239,620,204 33,083,609(40%)
edge 11,015,468 1 2 4 11 7164 8.75 0 96,380,983
reads 82,283,738 6,006,712,874

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T17:29:41Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28934 100 111 136 426 23376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61152 100 121 151 200 30846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum readOnContig
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204 33,083,609
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T17:28:45Z

Dpuiu: /* SOAPdenovo's */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72 28934 100 111 136 426 23376 378.53* 0 10,952,507
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131* 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100 61152 100 121 151 200 30846 286.05 0 17,492,450

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T17:22:31Z

Dpuiu: /* Reads (Drosophila) */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T15:41:37Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T15:41:21Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T15:40:59Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 25482 100 127 262 993 239672 1339.89 0 34143040
ctg 265450 32 34 50 121 49599 143.69 0 38141459
edge 530926 1 3 11 40 41918 63.06 0 33477999

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 25482 100 127 262 993 239672 1339.89 0 34143040
cE_coli 205 100 252 2244 30571 239672 21916.78 0 4492939
cpFosDT5_2 17 100 118 171 272 855 275.24 0 4679
cChloroplast 31 100 130 322 1363 5717 986.52 0 30582
cBAC 15668 100 133 336 1529 33075 1559.92 0 24440863
other 9574 100 117 171 522 27341 542.74 0 5196233

Pine tree

2011-08-11T15:28:39Z

Dpuiu: /* Reads (Drosophila) */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:28:28Z

Dpuiu: /* Reads (Drosophila) */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:27:47Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito: 83 scaffolds ~358162bp

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:27:06Z

Dpuiu: /* NCBI */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:26:56Z

Dpuiu: /* NCBI */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:26:10Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:25:56Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:25:45Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T15:25:04Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444
total 85289 # ~21X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:55:20Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:54:58Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:54:45Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:54:28Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:54:00Z

Dpuiu: /* SOAPdenovo's */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K31 -d0 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1,485,269,562

-K31 -d2 -max_rd_len72
-K31 -d2 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23,998,536
-K31 -d2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58,635,190

-K31 -d20 -max_rd_len100 7859* 100 113 139 284 43079 331.49 . 2,605,184
-K31 -d48 -max_rd_len100 3626 100 113 139 255 43131 339.01 . 1,229,250

-K47 -d0 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48,284,629
-K47 -d2 -max_rd_len100

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:37:27Z

Dpuiu: /* SOAPdenovo's */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:37:01Z

Dpuiu: /* == */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:36:49Z

Dpuiu: /* == */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

========================================================
= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:36:35Z

Dpuiu:

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

==========================================================
== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462 # VERY BAD
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 # VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

========================================================
= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:26:33Z

Dpuiu: /* Reads */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination:
lane #reads #cChloroplast #cBAC #mito
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.054%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) (0.12%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)
total ? # ~20X cvg for 100bp read len & 400K mito genome

* alignments:
program: bwa bwasw
cChloroplast ref: 1 seq
cBAC: 101 seqs
mito:

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:19:42Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:17:55Z

Dpuiu: /* NCBI */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads

* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266

* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

* Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903
mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

* Cycas_taitungensis mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:16:48Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads
* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266
* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 74820 100 105 125 390 31673 320.75 0 23998536
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database ; Cycas_taitungensis was top hit
other.long.hiGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

* Cycas_taitungensis mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:14:55Z

Dpuiu: /* SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads
* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266
* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473 # align to mito database
other.5K+.highGC 45 5066 6717 8233 10488 31673 9662.07 0 434793

* mito : scaffolds aligned to at least one of the 31 complete plant mitochondrion sequence
* Cycas_taitungensis mitochondrion sequence (most hits)
* Cycas_taitungensis mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:10:56Z

Dpuiu: /* NCBI */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads
* BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266
* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473

* mito : scaffolds aligned to at least one of the 31 complete plant mitochondrion sequence
* Cycas_taitungensis mitochondrion sequence (most hits)
* Cycas_taitungensis mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T14:09:11Z

Dpuiu:

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU]
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''

= Data =

== NCBI ==

* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces] BAC 454 reads
* BAC assembled sequences : AC241263..AC241361
* Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum
len 31 45223 209482 414903 539368 982833 402851 12488404
gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473

* mito : scaffolds aligned to at least one of the 31 complete plant mitochondrion sequence
* Cycas_taitungensis mitochondrion sequence (most hits)
* Cycas_taitungensis mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664

Pine tree

2011-08-11T13:47:45Z

Dpuiu: /* SOAPdenovo-31mer -K 27 -d 2 -D 3 -max_rd_len 100 */

= Links =

* [https://dendrome.ucdavis.edu/TGPlone dendrome@ucdavis]
* [http://www.pinegenome.org/pinerefseq pinegenome.org]
* [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3352 NCBI Taxonomy record] Pinus taeda or "loblolly pine"
* [http://www.pine.msstate.edu/bac.htm LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU] AC241263..AC241361
* [http://www.ncbi.nlm.nih.gov/pubmed/21283709 Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine.] PLoS One Jan 2011
Abstract:
''Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).''
* [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies&f=study&term=%28Pinus+taeda%29+&go=Go SRA traces]

= Data =

== UCDAVIS plone ==
* Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq
dpuiu
ddr5fft6
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
* Documents
** [[Media:PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods|PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods]] 21 July 2011

== IPST ftp ==
ftp genomepc1.umd.edu
ftpuser
pinegenome

cd PineUpload052911/
bin
prompt # no Y/N?
mget *

== Local data ==
ginkgo:
/fs/szattic-asmg7/PINE/PineUpload052911
/fs/szattic-asmg7/PINE/PineUpload070711

= PineUpload052911 =

== Chloroplast ==
len gc%
cChloroplast 120481 38.55

== cBACs ==
. elem min q1 q2 q3 max mean n50 sum
len 102 8288 89909 116121 140549 172161 113400 126689 11566806
gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87

== Reads ==
lane readLen #mates mea,std ~gc%
FC638TR_001_8 146 22,729,231 400 39.04
FC638TR_002_8 146 18,412,638 400 39.04

* Quality decreases sharply after pos 120 [[Media:FC638TR.qual.png|FC638TR.qual.png]]
* First 10bp of each read have higher AG count [[Media:FC638TR.content.png|FC638TR.content.png]]
* Over 0.5% Ns certain positions [[Media:FC638TR.Ns.png|FC638TR.Ns.png]]

fwd: 1.015% pos=100 ; 0.81% pos=119
rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21

* GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)

* Contamination: bwa bwasw
lane #reads #cChloroplast #cBAC
FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%)
FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%)
FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%)
FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%)

== SOAPdenovo's ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
-K47 -max_rd_len100 211820 100 143 156* 187 23273 227.95 . 48284629

-K31 -max_rd_len100 13747338 100 100 100 100 9185 108.04 . 1485269562
-K31 -d2 -D3 -max_rd_len100 74820 100 105 125 390 31673 320.75 . 23998536
-K31 -d20 -M3 -max_rd_len100 7859* 100 113 139 284 43079* 331.49 . 2605184*

-K27 -d 2 -D 3 -max_rd_len100 70246 100 107 137 413 30683 369.81 . 25977758
-K27 -d 2 -D 2 -max_rd_len146 224963 100 110 128 343 23410 260.64 . 58635190

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 74820 100 105 125 390 31673 320.75 0 23998536
ctg 5755282 32 32 35 43 7195 41.63 0 239620204
edge 11015468 1 2 4 11 7164 8.75 0 96380983

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
cChloroplast 206 100 122 159 229 767 191.56 0 39462
cBAC 10533 100 113 143 428 26589 477.68 0 5031439
mito 83 105 448 1730 6851 26364 4315.20 0 358162
other 63998 100 104 122 382 31673 290.16 0 18569473

* mito : scaffolds aligned to at least one of the 31 complete plant mitochondrion sequence
* Cycas_taitungensis mitochondrion sequence (most hits)
* Cycas_taitungensis mitochondrion vs chloroplast: [[Media:Cycas_taitungensis_mito-chloroplast.png|Cycas_taitungensis_mito-chloroplast.png]]
NC_009618 chloroplast 163,403
NC_010303 mitochondrion 414,903

* Reads aligned to mitochondrial scaffolds (bwa bwasw)
lane #hits %hits
FC638TR_001_8_1 12307 0.054
FC638TR_001_8_2 11933
FC638TR_002_8_1 28707 0.12
FC638TR_002_8_2 27211
total 80158 # 20X cvg for 100bp read len & 400K mito genome ; 29X cvg for 146bp read len

== SOAPdenovo-31mer -K 31 -d 20 -M 3 -max_rd_len 100 ==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 7859* 100 113 139 284 43079* 331.49 . 2605184
ctg 200062 32 33 37 47 10392 48.52 . 9707307

# scaffold length stats
. elem min q1 q2 q3 max mean n50 sum
all 7859* 100 113 139 284 43079* 331.49 . 2605184
cChloroplast 20 111 193 436 6140 43079 5951.05 0 119021
cBAC 5117 100 114 141 320 13733 334.94 0 1713870
mito 8 101 134 685 1396 2166 749.75 0 5998 !!! VERY BAD
other 2714 100 111 133 226 7353 282.35 0 766295

== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 -M 3 choloplast_mated_reads==
#scaffold stats
. elem min q1 q2 q3 max mean n50 sum
scf 20 111 193 436 6140 42707 5928.20 0 118564

= PineUpload070711 =

== Ecoli ==
len gc%
cE_coli 4639675 50.79

== Cloning vector ==
len gc%
pFosDT5_2 8345 47.93

== Drosophila refseq ==

* [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome&Cmd=ShowDetailView&TermToSearch=6185 NCBI Genome Overview]
Chromosome len gc%
2L 23,011,544 41
2R 21,146,708 43
3L 24,543,557 41
3R 27,905,053 42
4 1,351,857 35
X 22,422,827 42
un 10,049,037 ?
mitochondrion 19,517 17
total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100

== Reads (Drosophila) ==

lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC
FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%)
FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)

lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloroplast %cBAC %other
FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 34 # sampled 100K

TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4%
TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7%

TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5%
TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9%

TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1%
TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3%

TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0%
TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%

* kastevens@ucdavis.edu:
** The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
** Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
** Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
** The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
** The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
** However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
** Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
** Drosophila libraries run in lane 2 at nominal density.

== SOAPdenovo-31mer -K 31 -d 2 -D 3 -max_rd_len 100 ==
#stats
. elem min q1 q2 q3 max mean n50 sum
scf 20441 100 124 374 1980 291000 2575.50 0 52645707
ctg 802463 32 33 39 63 73415 91.13 0 73131767
edge 1013801 1 2 7 32 30919 48.85 0 49525815

#scf alignments
. elem min q1 q2 q3 max mean n50 sum
all 20441 100 124 374 1980 291000 2575.50 0 52645707
cE_coli 149 100 325 6612 41908 291000 30160.59 0 4493928
cpFosDT5_2 0
cChloroplast 58 105 166 374 1950 24932 1875.86 0 108800
cBAC 12294 100 141 785 4204 45781 3513.34 0 43192987
other 7953 100 113 171 599 41416 619.60 0 4927664