Bos taurus 3.0

From Cbcb
Jump to: navigation, search

Sequence

The genome of the domestic cow, Bos taurus, was sequenced using a mixture of hierarchical and whole-genome shotgun sequencing methods.

Read download

  • All reads were downloaded from the NCBI Trace Archive (TA) ftp: ftp://ftp.ncbi.nih.gov/pub/TraceDB/bos_taurus/
  • There were 37,829,394 reads organized into 91 volumes
    • 36,820,485 WGS, SHOTGUN, CLONEEND & FINISHING reads
      • 36,170,352 quality reads
      • 650,133 quality-less reads
    • 1,008,909 EST & PCR reads
  • 25,312 read libraries

Sequencing centers

  • Most reads were sequenced by the Baylor College of Medicine
    TRACE_COUNT     CENTER_NAME     
 1  35629020        BCM             Baylor College of Medicine
 2  737900          NISC            NIH Intramural Sequencing Center
 3  652614          BCCAGSC         British Columbia Cancer Agency Genome Sciences Center
 4  378871          MARC            USDA, ARS, US Meat Animal Research Center
 5  114753          UIUC            University of Illinois at Urbana-Champaign
 6  107367          BARC            USDA, ARS, Beltsville Agricultural Research Center
 7  65171           TIGR            The Institute for Genome Research
 8  53556           GSC             Genoscope
 9  43033           CENARGEN        Embrapa Genetic Resources and Biotechnology
 10 18623           SC              The Sanger Center
 11 15301           UOKNOR          University of Oklahoma Norman Campus, Advanced Center for Genome Technology
 12 10651           TIGR_JCVIJTC    The Institute for Genomic Research, Traces generated at JCVIJTC
 13 2485            UIACBCB         University of Iowa Center for Bioinformatics and Computation Biology (UIACBCB)
 14 49              WUGSC           Washington University, Genome Sequencing Center
    37829394        total           total                                    

Trace counts

    TRACE_COUNT   CENTER_NAME     TRACE_TYPE_CODE        
 1  24863599      BCM*            WGS                    
 2  10748529      BCM*            SHOTGUN                
 3  737900        NISC            SHOTGUN                
 4  125597        BCCAGSC         CLONEEND               
 5  114753        UIUC            CLONEEND               
 6  65171         TIGR            CLONEEND               
 7  53556         GSC             CLONEEND               
 8  26246         CENARGEN        WGS                    
 9  25454         BARC            CLONEEND               
 10 16892         BCM*            CLONEEND               
 11 16787         CENARGEN        CLONEEND               
 12 15150         UOKNOR          SHOTGUN                
 13 10651         TIGR_JCVIJTC    CLONEEND               
 14 151           UOKNOR          FINISHING              
 15 49            WUGSC           CLONEEND               
    36820485      total

 16 527017        BCCAGSC         EST
 17 207204        MARC            EST
 18 171667        MARC            PCR
 19 81913         BARC            EST
 20 18623         SC              EST 
 21 2485          UIACBCB         EST
    1008909       total

Data processing

Data issues

Issues:

  • Qualities
    • 650,133 reads don't have quality values and can't be reliably trimmed
  • Libraries
    • There are totally 25,312 libraries
    • Very fragmented especially the SHOTGUN and CLONEEND ones; can't be accurately re-estimated by the assembler
  • Clear ranges
    • Many traces are missing vector trimming coordinates (CLV=CLIP_VECTOR_LEFT..CLIP_VECTOR_RIGHT) or don't contain 3' trimming information (CLIP_VECTOR_RIGHT==0)
    • The read CLV's are need by the Celera Assembler overlap based trimming module (OBT) as input
    • Solution: identify the sequencing vector & linker sequences for each library and re-trim the reads

Identify linkers

For each library identify linker sequences:

  • Separate forward/reverse reads
  • Identify most frequent kmers (8mers,24mers)
  • Check if kmers a overrepresented
  • Verify if the most frequent 8mer is present in the top 10 most frequent 24mers
  • Align 24mers (extend them by a few bp) => linker

Identify vectors

For each library identify vector sequences:

  • Align linkers to the opposite strand sequences (nucmer -l 12 -c 24 -r)
  • Extract the subsequences following to linker (50..150bp)
  • Align the subsequences; if they align we've probably identified the vector
  • Identify the vector name/id by alignment to the UniVec database (nucmer -l 12 -c 24)
  • Check if the forward/reverse vector(s) are the same : we should find a common vector sequence; the UniVec alignments should be adjacent
  • create the Lucy vector & splice files that contain the linker+vector sequences

Trimming

  • Run Lucy on quality reads
  • Get CLV statistics: depending on the library, the Lucy CLV is 20bp+ shorter than the original CLV
  • Trim reads according to Lucy output CLV
  • Align Lucy trimmed reads to linker,vector,splice site & UniVec (there should be no alignments)
  • Method worked on BCM & NISC libraries (~ 98% of the reads)
  • For the other reads use the factory clipping points

BCM reads

  • linker:
 >J01636.linker.fwd 27bp
 TCGAGTTCGACTGCAAGTAGTTCATCA
 >J01636.linker.rev 27bp
 CTAATCAGATGGTACAGTAGTTCATCA
  • vector: J01636 E.coli lactose operon with lacI, lacZ, lacY and lacA genes (7477 bp)
  • avg(original CLV) - avg(Lucy CLV)> 20bp (1015 vs 973 in quality WGS reads , ...)

NISC reads

  • linker:
 >NGB00080.linker.fwd 24bp
 TATCATCGCCACTGTGGTGGAATT
 >NGB00080.linker.rev 26bp
 GCTGAAGCTCCATGTGGTGGAATTCC
  • vector NGB00080 (pOTW13 with linkers)
  • avg(original CLV) - avg(Lucy CLV)> 20bp (771 vs 747)

Preliminary assembly

  • Assembly version: wgs-5.2
  • Use only quality reads
  • Set read CLV to Lucy CLV or original CLV
  • Set non random flag = 1 on all reads except for WGS ones
  • Set obtMerThreshold = 200 (default 1000)
  • Set doOBT = 1

Input

 Reads=35,348,776 # WGS, SHOTGUN, CLONEEND & FINISHING quality reads
 Libraries=25,312   # mostly SHOTGUN and BARC.CLONEEND

Output

 TotalScaffolds=66,141
 MaxBasesInScaffolds=26,048,998
 MeanBasesInScaffolds=40,861
 
 TotalContigsInScaffolds=120,461
 MaxContigLength=627,911
 MeanContigLength=22,436
 
 TotalDegenContigs=269,031
 MaxDegenContig=33,824
 
 SingletonReads=3,721,123
 DeletedReads=421,379 (too short or zero CLR)

Preliminary assembly processing

Read clear ranges

  • Quality reads: extract OBT CLR from gatekeeper store
  • Qualityless reads:
    • Align them to contigs (no degenerates) : nucmer -l 50 -c 200 -b 10 -g 5 -d 0.05
    • Set CLR to the maximum alignment coordinates or 50..min(len,600)
    • Reduce CLR if there are multiple N's or low complexity regions in the read

Contaminant search

Databases:

  • Ecoli : 22 completed genomes + plasmids
  • UniVec_Core 1,348 sequences : mostly cloning vectors & primers, avg 250bp long
  • OtherVec: 100 other vector sequences (mostly complete), identified by aligning UMD2.0 contaminants to GenBank
  • bos_taurus UMD2.0 contaminant : 4,813 whole contigs and 30,329 partial contigs identified by NCBI as contamination in UMD2.0; many partial contigs contained cow sequences as well
  • Databases FASTA files:
 /nfshomes/dpuiu/db/Ecoli.all
 /nfshomes/dpuiu/db/UniVec_Core
 /nfshomes/dpuiu/db/OtherVec
 /nfshomes/dpuiu/db/bos_taurus.UMD2.contaminant.fasta

Alignment parameters:

 nucmer -maxmatch -l 40 -c 100 -b 10 -g 5 -d 0.05 

Contig/degenerate counts:

  • 2,951/1,266 aligned to Ecoli
  • 5,387/1,908 aligned to UniVec_Core
  • 5,657/1,963 aligned to OtherVec

Read/mate counts: TO BE DELETED

  • 40,699/22,607 in contaminated regions

Library estimates

  • Some library estimates are complete wrong
 Example: BCM.SHOTGUN libraries listed as long (180Kbp mean) are all short (2-6Kbp mean)  
  • Extract library insert estimates; merge libraries sequenced by same center that have similar mean/std : 25,312 libs => 344 libs
  • Assign new library ids; assign average means & stdevs to the libraries

Final assembly

  • Assembly version: wgs-5.2
  • Use all traces
  • Set read CLR to:
    • Quality reads: OBT CLR
    • Qualityless reads: alignment coordinates or 50..min(len,600)
  • Set nonRandom flag = 1 on all reads except for WGS reads
  • Set deleted flag = 1 on all reads deleted by OBT in the preliminary assembly
  • Set obtMerThreshold = 200 (default 1000)
  • Set doOBT = 0 (reads have been already trimmed)

Input

 Reads=35,973,728   # WGS, SHOTGUN, CLONEEND & FINISHING with and without qualities
 Libraries=344

Output

 TotalScaffolds=39,978
 TotalContigsInScaffolds=90,135
 MeanBasesInScaffolds=66,947
 MaxBasesInScaffolds=3,3907,885
 
 TotalContigsInScaffolds=90,135
 MeanContigLength=29,693
 MaxContigLength=1,160,130
 
 TotalDegenContigs=251,413
 MaxDegenContig=39,964

 SingletonReads=3,634,305(10.24%)

Final assembly processing

Contaminant search

  • Use same databases and alignment parameters as in preliminary assembly processing
  • Delete full contaminants & trim partial contaminants

Delete summary:

  • 65 Acinetobacter ctgs
  • 91 other contaminant ctgs <2Kbp
  • Total: 156 ctgs, 152 scf, 4105 reads

Trim summary:

  • 12 contigs >=2Kbp , 44 reads

Marker mapping

  • 126,013 total markers
  • Avg distance between markers is 25Kbp; marker position error is 50Kbp
  • Markers were aligned to all contigs/degenerates
  • Best alignments with %IDY>90 & %Matched>85 were identified
  • 107,271 markers align to 31,407 ctg & 2,640 scf
    • 552 scf have markers from multiple chromosomes
    • 212 scf have multiple markers from multiple chromosomes
    • 38 scf have multiple adjacent markers from multiple chromosomes: MIGHT BE MISASSEMBLED
  • 628 markers align to 562 degenerates

Scaffold/contig breaking

  • Analyze 38 scf that have multiple adjacent markers from multiple chromosomes
  • Compute coverage in the suspicious region (between different chromosome markers):
    • read cvg
    • mate ctg: good, bad
  • Break ctg/scf unless the region has "high read cvg" , "high good mate cvg" , "low bad mate cvg"
  • Break summary:
    • 14 scaffolds
    • 15 breaks : 8 on the same contig , 3 on adjacent contigs , 4 on non adjacent contigs

Assignment to chromosomes

Markers

  • 2640 scaffolds and 562 degenerates have markers
  • Assignment to chromosomes: use best alignment & majority rule
  • Position:
    • Filter out outliers according to position on chromosome & scaffold (interquartile range method)
    • Compute the average position on chromosome of the markers
  • Orientation:
    • use LeastSequareFit method : if slope is positive => forward; if slope is negative => reverse
    • if only 1 markers/scaffolds => direction=unknown (0)

Human synteny

  • Align all scaffolds/degenerates to the 24 Human chromosomes; filter all alignments longer than 200bp
 nucmer -mum -l 12 -c 30 -g 1000
 delta-filter -q -l 200 
  • 9,914 scaffolds and 16,527 degenerates align to Human chromosomes; most alignments are short, just over 200bp

Combine Human synteny & Marker data

  • 1,908 scaffolds and 118 degenerates both align to human and contain markers
  • 10,790 scaffolds and 16,590 degenerates align to human or contain markers
  • Try to infer the position/orientation on the chromosomes for the scaffolds/degenerates that align to human but contain no markers
  • Iteratively:
    • Find 2 adjacent scaffolds (preferably on left & right side) which both align to human, contain markers and placements agree (chromosome, position, direction)
    • Otherwise, find 1 adjacent scaffolds which both aligns to human, and contains markers
    • Extrapolate the position/orientation of the "unplaced" sequence based on its neighbor(s)
    • Sort the scaffolds/degenerates based on chromosome positions, identify incorrect markers & alignments, remove them from the input data and repeat the process

By linking information

  • Once scaffolds/degenerates were assign to chromosome use mate pair information to refine placements
  • Identify unplaced scaffolds/degenerates linked to placed scaffolds/degenerates and fit them into gaps

Comparison to UMD2.0

Alignment parameters:

 nucmer -mum -l 200 -c 1000

Haplotype search

Daniela:

  • Place scf/deg on Chr
  • Align each pair X,Y (len(X)<len(Y))of adjacent/overlapping scf/deg : nucmer -mum -l 40 -c 250 ( => avg 96 %id)
  • compute (X,Y) cvg
  • identify the X regions which had no alignments to Y; if the length of these regions were less than 2K bp => X is a variant

Guillaume:

  • there is a contig Y larger than X and, X and Y are placed on top of each other (with some play allowed)
  • there are a high quality sequence alignment such that: at least 200 bases out of the first 400 bases of X align with Y AND at least 200 bases out of the last 400 bases of X align with Y.
  • In other word, the ends of X have to align well with Y, but the middle can be significantly different.

Files:

 /fs/szasmg3/bos_taurus/UMD_Freeze3.0/contigs.haplotype-variants.fa.gz            # 40611 haplotype-variants sequences
 /fs/szasmg3/bos_taurus/UMD_Freeze3.0/contigs.haplotype-variants.ids              # 40611 haplotype-variants sequence ids
 /fs/szasmg3/bos_taurus/UMD_Freeze3.0/contigs.haplotype-variants.pairs            # 40300 pairs (haplotype-variants & reference sequences)
 /fs/szasmg3/bos_taurus/UMD_Freeze3.0/contigs.haplotype-variants.pairs.delta      # 39665 alignment pairs (haplotype-variant is the query)
 /fs/szasmg3/bos_taurus/UMD_Freeze3.0/contigs.haplotype-variants.pairs.cvg        # 39665 coverage  pairs (ref=col 1 ; haplotype-variant=col 5)

Summary:

 .                    elem       <=0        >0         min    max        mean       med        n50        sum
 ctg+deg              40611      0          40611      263    97877      1476       1205       1372       59958728
 ctg                  29452      0          29452      471    97877      1631       1297       1469       48039280
 deg                  11159      0          11159      263    12208      1068       979        1006       11919448

Other Files

/scratch1/bos_taurus/Assembly/2009_0312_CA/scf_placements/UMD_Freeze3.0/
 39864 contigs.haplotype-variants.daniela.pairs
   443 contigs.haplotype-variants.guillaume.pairs
   436 contigs.haplotype-variants.guillaume.pairs.orig
   334 contigs.haplotype-variants.ids.missing

Issues:

 .                    elem       <=0        >0         min    max        mean       med        n50        sum
 missing              339        0          339        462    97877      1613       1011       1204       547135
 mislabeled           6          0          6          2973   97877      31271      8275       97877      187628

Mislabeled haplotypes:

 Chr      begin      end        Pos   W  ctg            1  len    dir
 Chr2     131428091  131475109  5387  W  7180001925346  1  47019  +
 Chr3     11270384   11278308   637   W  7180002020315  1  7925   -
 Chr12    9183395    9281271    429   W  7180002024890  1  97877  +
 Chr14    34404395   34412669   3579  W  7180002021388  1  8275   -
 Chr15    50865607   50889165   2531  W  7180002015261  1  23559  -
 ChrU     8589989    8592961    5791  W  7180002026074  1  2973   +

Chromosome mapping

Assembly Summary

...

Hs vs Bt

  • Goal: find all syntenic regions longer than a certain % of the Cow/Human genome
  • Chromosome counts (include gaps)
 .                    elem       min      q1       q2        q3        max        mean       n50        sum(all)        sum(no gaps)            
 human                24         46944323 78774742 134452384 170899992 247249719  128350811  154913754  3,080,419,480   2,858,012,910  
 cow                  31         9828056  61435874 84240350  113384836 158337067  86152724   105708250  2,670,734,461   2,649,997,198
  • Gap counts
 .                    elem       min      q1       q2        q3        max        mean       n50        sum
 human                290        100      35000    47000     90000     30000000   766919     17918000   222,406,570 => 7.2% gaps
 cow                  72454      1        99       99        248       1074158    286        698        20,737,263  => 0.7% gaps
  • nucmer params: -l 12 -c 65 -g 1000 -b 1000
  • delta-filter -l 200
  • 24 * 30 = 720 alignments (except for BtChrU)
  • Alignment stats (filter-q)
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 len                  392789     11     440    749    1244   34597      1015       1376       398713561 
 %id                  392789     30.06  74.72  77.89  81.61  100.00     78         78         .
  • Alignments counts
                               >=200    >=2000   >=5000
 HsChr-BtChr.delta             532,866  39,663   3,570
 HsChr-BtChr.filter-1.delta    392,789  38,185   3,560
  • Filter and merge alignments
 cat HsChr-BtChr.filter-1.delta |  ~/bin/shrinkIds.pl | ~/bin/DELTA/delta2anc.pl  | sed 's/NC_//' | sort -nk1 -nk5 | sed 's/^/NC_/' >! HsChr-BtChr.anc
 cat HsChr-BtChr.anc            |  ~/bin/DELTA/filter-anc.pl -p 0.2 >! HsChr-BtChr.filter.anc 
 cat HsChr-BtChr.filter.anc     | ~/bin/DELTA/merge-anc.pl >! HsChr-BtChr.merge.anc
 cat HsChr-BtChr.merge.anc      | ~/bin/DELTA/anc2delta.pl >! HsChr-BtChr.merge.delta
    
 392789 HsChr-BtChr.anc
 368848 HsChr-BtChr.filter.anc
    380 HsChr-BtChr.merge.anc : 380 syntenic regions !!!
  • Alignment lengths
 .                    elem       min    q1      q2      q3       max        mean       n50        sum            
 filter-1             392789     11     440     749     1244     34597      1015       1376       398713561   => 13.9% of finished human covered    
 merge                323        191406 1363213 3413785 10424392 86757102   8304710    19750702   2682421368  => 93.8% of finished human covered

  • Coverage
 cat HsChr-BtChr.merge.delta | ~/bin/delta2cvg.pl -m 2 | getSummary.pl -i 4 -t 2+cvg
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 merge(2+cvg)         15         174    222    341    541    1651       455        541        6829   !!! only 6K in overlapping regions
  • Plot
 cat HsChr-BtChr.merge.delta | ~/bin/DELTA/mummerplot.pl
 cat HsChr-BtChr.merge.anc | sed 's/NC_00000//' | sed 's/NC_0000//' | sed 's/Chr//' | sed 's/X/30/' | p '@F[6,7]=@F[7,6] if($F[6]>$F[7]); print join " ", @F[0,4,5,1,6,7]; print "\n";' > HsChr-BtChr.merge.map
 ~/bin/map-draw.pl -rl HsChr.len -ql BtChr.len  -rg HsChr.gaps -qg BtChr.gaps HsChr-BtChr.merge.map >! HsChr-BtChr.merge.png

Submission

Issues

 3 tbl2asn.3Nucleotides.ids    # 3 deg
13 tbl2asn.InternalNs.ids
 7 tbl2asn.TerminalNs.ids      # 3 deg

NCBI contaminant search

 Abbr.   Screen type        Total   Exclude   Mask/trim
 x_dist  Not chordata       15      8 	 
 x_mito  Mitochondrial      75      74 	                 # +2 degenerates found later on
 x_rel   Primates, Glires   61      18 	 
 x_vec   Vector             72      17        52
  • 115 sequences to exclude (with apparent source)
  • 56 sequences with locations to mask/trim (with apparent source)
  • More mito contaminants that got deleted:
 contig 7180001836672 (941 bp) Chr4
 contig 7180001872458 (1216 bp) Chr7

USDA validation

  • contigs where the USDA markers are:
 #ctgid           chr   chrStart  chrEnd    chrDir  gap  gapLen  scfid          scfStart  scfEnd   scfDir
 7180001851853    Chr4  14880886  14905494  f       N    262     7180002041025  0         24609    f  # UMD2.ChrX
 7180001851854    Chr4  14905757  14975933  f       N    89      7180002041025  25050     95227    f  # UMD2.ChrX
 7180001851855    Chr4  14976023  15035183  f       U    100     7180002041025  95247     154408   f  # UMD2.ChrX
 7180001851862    Chr4  15097101  15112881  f       N    277     7180002041025  214346    230127   f  # UMD2.ChrU
 7180001851863    Chr4  15113159  15217082  f       U    100     7180002041025  230471    334395   f  # UMD2.ChrU
 7180001851868    Chr4  15315244  15402777  f       U    100     7180002041025  428933    516467   f  # UMD2.ChrU
 7180001851869    Chr4  15402878  15481630  f       U    100     7180002041025  516487    595240   f  # UMD2.ChrU
 7180001851870    Chr4  15483895  15545907  f       N    1420    7180002041025  595301    657314   f  # UMD2.ChrU
 7180001851877    Chr4  15750682  15829262  f       N    113     7180002041025  872729    951310   f  # UMD2.Chr4
 7180001851878    Chr4  15829376  15899492  f       U    100     7180002041025  951330    1021447  f  # UMD2.Chr4
 7180001851883    Chr4  16063597  16181903  f       U    100     7180002041025  1185217   1303524  f  # UMD2.Chr4

 7180002017095    Chr4  46537074  46586634  f       N    106     7180002041269  4370630   4420191  f  # UMD2.ChrX ; 49,561bp ctg (ctg 60 out of 68 in the scaffold)
  • scf7180002041025 & scf7180002041269 should go on Chr X
 scf7180002041025 1504672 (1.5Mbp) 40 ctgs
 scf7180002041269 5135095 (5.1Mbp) 68 ctgs

scf7180002041025

  • aligns to human ChrX
  • has cow Chr4 markers
 #scfid        chr #markers
 7180002041025 4   6
    • 4 more scaffolds that align inside of it got placed on Chr4
    • ChrX synteny break
 #id              HS-ref      #alignments slope       begin       end         len         BT-ref      #markers    slope       begin       end           # ctgs
 
 #before: scf 7180002041067
 #7180002041067   23          218         1.2073      110927695   111673606   745911      30          11          0.8025      68190660    68936571    
 
 7180002041025    23          170         -0.7174     114577935   116082607   1504672     4           6           0.9532      15769548    17274220      40
 7180002035944    23          3           -0.0005     115565458   115615980   50522       .           .           .           .           .             6  # 1 link to 7180002041025, 1 link to 7180002041025(Chr14)
 7180002038855    23          1           -1.0258     115614308   115620479   6171        .           .           .           .           .             1
 7180001954604    23          2           0           115819587   115820534   947         .           .           .           .           .             1 (deg)
 7180002066413    23          1           0.996       115849570   115850802   1232        .           .           .           .           .             1  # 1 link to 7180002041025 , 4 links to 7180002040813(Chr23)
 
 #after: scf 718000204081 (ctg 7180001725840..7180001725857)
 #7180002040813   23          448         0.9565      116445525   117676925   1231400     30          23          0.8741      208791      1440191
  • 7180002041025 has 2 mate links to 7180002040813 & zero links to 7180002041067
 #read1          read2           type            scf1            begin1  end1    dir1    scf2            begin2  end1    dir2
 448279509       581499140       diffScaffold    7180002041025   14677   15288   r       7180002040813   156247  156894  r        # 581499140(UIUC CLONEEND)
 395754360       395754351       diffScaffold    7180002041025   86506   87216   r       7180002040813   21906   22622   r        # 395754351(TIGR CLONEEND)

MOVE 5 SCF (48 CTG + 1 DEG = 49 CTG/DEG) FROM Chr4 TO ChrX: 7180002041025 ...
BEFORE SCF 7180002040813 (reads 395754351,581499140) : 1st scf in Chr30, forward

scf7180002041269

  • has 1 marker from cow ChrX
 #scfid        chr #markers
 7180002041269 4   211
 7180002041269 2   2
 7180002041269 27  1
 7180002041269 X   1  
 #Marker     Chr_BTA  Pos(Kbp)   CI_Pos_from  CI_Pos_to  UMD_Ctg_Pos  Match_Len  %IDY   %Matched  UMD_Ctg_name
 BZ868101    30       117730101  117682601    117777601  32868        607        99.84  100.00    7180002017095
 7180002017095(49561bp) --(8)--> 7180001836903(5012bp) --(10)--> 7180002017096(14286bp) --(3)--> 7180002000237(5737bp) --(7)--> 7180002017097(67824bp,Chr4)
                                                                                        --(4)--> 7180001765615(2394bp)
  • 1Kbp+ alignments:
  26294    27384  | 34011599 34012646  |     1091     1048  |    74.49  |    49561 154913754  |     2.20     0.00  | 7180002017095     gi|89161218|ref|NC_000023.9|NC_000023
  10631    12096  | 34107297 34108751  |     1466     1455  |    82.36  |    14286 154913754  |    10.26     0.00  | 7180002017096     gi|89161218|ref|NC_000023.9|NC_000023

BREAK SCF 7180002017096
MOVE 3 CONTIGS FROM Chr4 TO ChrX: 7180002017095, 7180001836903, 7180002017096 ( align to human ChrX)
BETWEEN ctg 7180002005166,7180002013375 ; forward

 #scfid          HS-ref  #align  slope   HS-beg          HS-end         scflen   #ctgid
 7180002035547   23      7       -0.6625 33257979        33286095       28116    7180002005166|7180002013375 (2ctg scf)
 ...
 7180002040082   23      4       1.4432  34269717        34305189       35472    7180002021537 (1ctg scf)
 #BT agp
 ChrX    113665631       113671433       13435   W       7180002005166   1       5803    +
 ...
 ChrX    113671746       113693999       13437   W       7180002013375   1       22254   +

  • MOVE 50 CTGS from Chr4 to ChrX (2 variants 7180001912167 & 7180001954604 skipped)
 1,532,083 bp in ctg & gaps
 1,513,442 bp in ctg 
 18,641 bp in gaps
       Before                    After
 Chr4  122,361,782(2,761 ctg)    120,829,699(2,711 ctg)
 ChrX  147,291,816(8,628 ctg)    148,823,899(8,678 ctg)

Wrong Haplotypes

Dpuiu 15:16, 24 August 2009 (EDT)

Mislabeled haplotypes:

 Chr      begin      end        Pos   W  ctg            1  len    dir
 Chr2     131428091  131475109  5387  W  7180001925346  1  47019  +
 Chr3     11270384   11278308   637   W  7180002020315  1  7925   -
 Chr12    9183395    9281271    429   W  7180002024890  1  97877  +
 Chr14    34404395   34412669   3579  W  7180002021388  1  8275   -
 Chr15    50865607   50889165   2531  W  7180002015261  1  23559  -
 ChrU     8589989    8592961    5791  W  7180002026074  1  2973   +

New files:

 /scratch1/bos_taurus/Assembly/2009_0312_CA/scf_placements/UMD_Freeze3.1

Mislabeled haplotypes (added back to the assembly)

 Chr      begin      end        Pos   W  ctg            1  len    dir
 Chr2     131428091  131475109  5387  W  7180001925346  1  47019  +
 Chr3     11270384   11278308   637   W  7180002020315  1  7925   -
 Chr12    9183395    9281271    429   W  7180002024890  1  97877  +
 Chr14    34404395   34412669   3579  W  7180002021388  1  8275   -
 Chr15    50865607   50889165   2531  W  7180002015261  1  23559  -
 ChrU     8589989    8592961    5791  W  7180002026074  1  2973   +

NCBI links

--Dpuiu 15:54, 9 September 2009 (EDT)

  • We have released the 02 version of your WGS project plus the scaffolds and chromosomes:
 GPID    Orgname     WGS number  
 --------------------------------
 32899	Bos taurus DAAA00000000
 GK000001-GK000030	= chromosomes (made from the scaffolds)
 GJ011756-GJ060422	= 48,667 scaffolds
  • The chromosomes are updates to the pre-existing accession numbers, so they are now the .2 version.
  • GK000001-GK000030 are chr1-29 and chrX, respectively.
  • We added the last 6 contigs to the WGS project, so it has 75770 contigs.
  • There will be the usual indexing delay before text searches and the hyperlinks function correctly.
 GK000001-GK000030	chromosomes (same accession numbers)
 GJ060423-GJ063645	placed scaffolds (new accession numbers)
 GJ057137-GJ060422	unplaced scaffolds (same accession numbers)

CBCB links

 http://www.cbcb.umd.edu/research/production_assembly.shtml
 ftp://ftp.cbcb.umd.edu/pub/data/assembly/Bos_taurus/Bos_taurus_UMD_3.0  ->  /fs/ftp-cbcb/pub/data/Bos_taurus/Bos_taurus_UMD_3.0
 ftp://ftp.cbcb.umd.edu/pub/data/assembly/Bos_taurus/Bos_taurus_UMD_3.0a ->  /fs/ftp-cbcb/pub/data/Bos_taurus/Bos_taurus_UMD_3.0a (alpha release)
 ftp://ftp.cbcb.umd.edu/pub/data/assembly/Bos_taurus/Bos_taurus_UMD_3.1  ->  /fs/ftp-cbcb/pub/data/Bos_taurus/Bos_taurus_UMD_3.1  (AGP gap specification change)
 /fs/szasmg3/bos_taurus/UMD_Freeze3.0       # AGP & Chr Seqs
 /fs/szasmg3/bos_taurus/UMD_Freeze3.1       # new AGP
 /fs/szasmg3/bos_taurus/UMD_Freeze3.1.NCBI  # NCBI Chr Seqs (NCBI ids)

Marker mapping

  • About 75% of the MARC markers and 87% of the ILTX seem to agree (chromosome number and approximate position).
BTAU4.2_UMD3.1.MARC.txt
BTAU4.2_UMD3.1.ILTX.txt
  • MARC markers mapping summary:
 total markers:        1384
 same chromosome:      1047
 different chromosome: 17
 BTAU4.2 only:         355
 UMD3.1 only:          13
  • ILTX markers mapping summary:
 total markers:        3396
 same chromosome:      2988
 different chromosome: 169
 BTAU4.2 only:         327
 UMD3.1 only:          0

Files:

 BTAU4.2 vs UMD3.1
 /fs/szasmg3/bos_taurus/markers/BTAU4.2_UMD3.1.MARC.txt
 /fs/szasmg3/bos_taurus/markers/BTAU4.2_UMD3.1.ILTX.txt  
 MARC makers
 /fs/szasmg3/bos_taurus/markers/9913.MARC.txt   : marker positions on BTAU4.2 (ftp file)
 /fs/szasmg3/bos_taurus/markers/UMD3.1.MARC.txt : marker positions on UMD3.1
 /fs/szasmg3/bos_taurus/markers/MARC.txt        : marker ids
 /fs/szasmg3/bos_taurus/markers/MARC.fwd.seq    : marker forward sequences
 /fs/szasmg3/bos_taurus/markers/MARC.rev.seq    : marker reverse sequences
 ILTX makers:
 /fs/szasmg3/bos_taurus/markers/9913.ILTX.txt   : marker positions on BTAU4.2 (ftp file)
 /fs/szasmg3/bos_taurus/markers/UMD3.1.ILTX.txt : marker positions on UMD3.1
 /fs/szasmg3/bos_taurus/markers/ILTX.txt        : marker ids
 /fs/szasmg3/bos_taurus/markers/ILTX.fwd.seq    : marker forward sequences
 /fs/szasmg3/bos_taurus/markers/ILTX.rev.seq    : marker reverse sequences