https://wiki.umiacs.umd.edu/cbcb/index.php?action=history&feed=atom&title=Pine_tree 2026-04-13T01:14:41Z Revision history for this page on the wiki MediaWiki 1.43.7 https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8914&oldid=prev 2011-08-11T21:35:41Z

<p><span class="autocomment">Reads</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 21:35, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l186">Line 186:</td> <td colspan="2" class="diff-lineno">Line 186:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   TIL_288_FC70M6V_2_001    160,156  9524524  288        .    80.0%</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   TIL_288_FC70M6V_2_001    160,156  9524524  288        .    80.0%</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   TIL_288_FC70M6V_3_001    160,156  6158919  288              83.0%</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   TIL_288_FC70M6V_3_001    160,156  6158919  288              83.0%</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2" class="diff-side-added"></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>* kastevens@ucdavis.edu:</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>* kastevens@ucdavis.edu:</div></td></tr> <tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l198">Line 198:</td> <td colspan="2" class="diff-lineno">Line 197:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the  </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the  </div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>** Drosophila libraries run in lane 2 at nominal density.</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>** Drosophila libraries run in lane 2 at nominal density.</div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* About 8.5% of the reads contain a high copy kmer . they don't get assembles</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AAAGAGTGTAGATCTCGGTGGT</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AACTCCAGTCACTTAGGCATCT</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AAGACGGCATACGAGATGCCTA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AAGAGTGTAGATCTCGGTGGTC</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AAGATCGGAAGAGCGTCGTGTA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AAGCAGAAGACGGCATACGAGA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AAGTGACTGGAGTTCAGACGTG</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACACGTCTGAACTCCAGTCACT</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACCGAGATCTACACTCTTTCCC</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACGAGATGCCTAAGTGACTGGA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACGGCATACGAGATGCCTAAGT</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACGGCGACCACCGAGATCTACA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACGTCTGAACTCCAGTCACTTA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> ACTCCAGTCACTTAGGCATCTC</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AGAAGACGGCATACGAGATGCC</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AGACGGCATACGAGATGCCTAA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AGACGTGTGCTCTTCCGATCTA</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AGAGTGTAGATCTCGGTGGTCG</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AGATCGGAAGAGCACACGTCTG</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"> AGATCGGAAGAGCGTCGTGTAG</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8913&oldid=prev 2011-08-11T20:25:36Z

<p><span class="autocomment">SOAPdenovo&#039;s</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 20:25, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l97">Line 97:</td> <td colspan="2" class="diff-lineno">Line 97:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len72          28,934      100    111    136    426    23,376    378.53*    0          10,952,507</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len72          28,934      100    111    136    426    23,376    378.53*    0          10,952,507</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len100        74,820      100    105    125    390    31,673    320.75    .          23,998,536   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len100        74,820      100    105    125    390    31,673    320.75    .          23,998,536   </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len146        <del style="font-weight: bold; text-decoration: none;">224</del>,<del style="font-weight: bold; text-decoration: none;">963 </del>    100    <del style="font-weight: bold; text-decoration: none;">110 </del>  <del style="font-weight: bold; text-decoration: none;">128 </del>  <del style="font-weight: bold; text-decoration: none;">343 </del>  <del style="font-weight: bold; text-decoration: none;">23</del>,<del style="font-weight: bold; text-decoration: none;">410 </del>    <del style="font-weight: bold; text-decoration: none;">260</del>.<del style="font-weight: bold; text-decoration: none;">64 </del>    <del style="font-weight: bold; text-decoration: none;">. </del>        <del style="font-weight: bold; text-decoration: none;">58</del>,<del style="font-weight: bold; text-decoration: none;">635</del>,<del style="font-weight: bold; text-decoration: none;">190</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len146        <ins style="font-weight: bold; text-decoration: none;">264</ins>,<ins style="font-weight: bold; text-decoration: none;">547 </ins>    100    <ins style="font-weight: bold; text-decoration: none;">108 </ins>  <ins style="font-weight: bold; text-decoration: none;">123 </ins>  <ins style="font-weight: bold; text-decoration: none;">169 </ins>  <ins style="font-weight: bold; text-decoration: none;">32</ins>,<ins style="font-weight: bold; text-decoration: none;">435 </ins>    <ins style="font-weight: bold; text-decoration: none;">228</ins>.<ins style="font-weight: bold; text-decoration: none;">49 </ins>    <ins style="font-weight: bold; text-decoration: none;">0 </ins>        <ins style="font-weight: bold; text-decoration: none;">60</ins>,<ins style="font-weight: bold; text-decoration: none;">445</ins>,<ins style="font-weight: bold; text-decoration: none;">493</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d20 -max_rd_len100        7,859*      100    113    139    284    43,079    331.49    .          2,605,184             </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d20 -max_rd_len100        7,859*      100    113    139    284    43,079    331.49    .          2,605,184             </div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8912&oldid=prev 2011-08-11T18:10:47Z

<p><span class="autocomment">PineUpload070711</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 18:10, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l201">Line 201:</td> <td colspan="2" class="diff-lineno">Line 201:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max      mean      n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max      mean      n50  sum <ins style="font-weight: bold; text-decoration: none;">              readOnContig</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   scf            20,441    100  124  374  1980  291,000  2575.50  0    52,645,707</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   scf            20,441    100  124  374  1980  291,000  2575.50  0    52,645,707</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            802,463  32  33  39    63    73,415  91.13    0    73,131,767</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            802,463  32  33  39    63    73,415  91.13    0    73,131,767 <ins style="font-weight: bold; text-decoration: none;">      37,254,577</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   edge            1,013,801 1    2    7    32    30,919  48.85    0    49,525,815</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   edge            1,013,801 1    2    7    32    30,919  48.85    0    49,525,815</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   reads          47,092,950</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   reads          47,092,950 <ins style="font-weight: bold; text-decoration: none;">                                              7,440,686,100</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> <tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l218">Line 218:</td> <td colspan="2" class="diff-lineno">Line 218:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max      mean      n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max      mean      n50  sum <ins style="font-weight: bold; text-decoration: none;">              readOnContig</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   scf            25,482    100  127  262  993    239,672  1339.89  0    34,143,040</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   scf            25,482    100  127  262  993    239,672  1339.89  0    34,143,040</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            265,450  32  34  50    121    49,599  143.69    0    38,141,459</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            265,450  32  34  50    121    49,599  143.69    0    38,141,459 <ins style="font-weight: bold; text-decoration: none;">      40,191,864(85%)</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   edge            530,926  1    3    11    40    41,918  63.06    0    33,477,999</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   edge            530,926  1    3    11    40    41,918  63.06    0    33,477,999</div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  reads          47,092,950                                              7,440,686,100</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8911&oldid=prev 2011-08-11T17:47:23Z

<p><span class="autocomment">PineUpload070711</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:47, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l201">Line 201:</td> <td colspan="2" class="diff-lineno">Line 201:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <del style="font-weight: bold; text-decoration: none;">    </del>min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">    </del>mean      n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <ins style="font-weight: bold; text-decoration: none;">    </ins>min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean      n50  sum</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   scf            <del style="font-weight: bold; text-decoration: none;">20441 </del>  100  124  374  1980  <del style="font-weight: bold; text-decoration: none;">291000 </del> 2575.50  0    <del style="font-weight: bold; text-decoration: none;">52645707</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   scf            <ins style="font-weight: bold; text-decoration: none;">20,441 </ins>  100  124  374  1980  <ins style="font-weight: bold; text-decoration: none;">291,000 </ins> 2575.50  0    <ins style="font-weight: bold; text-decoration: none;">52,645,707</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <del style="font-weight: bold; text-decoration: none;">802463 </del>  32  33  39    63    <del style="font-weight: bold; text-decoration: none;">73415 </del>  91.13    0    <del style="font-weight: bold; text-decoration: none;">73131767</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <ins style="font-weight: bold; text-decoration: none;">802,463 </ins>  32  33  39    63    <ins style="font-weight: bold; text-decoration: none;">73,415 </ins>  91.13    0    <ins style="font-weight: bold; text-decoration: none;">73,131,767</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   edge            <del style="font-weight: bold; text-decoration: none;">1013801  </del>1    2    7    32    <del style="font-weight: bold; text-decoration: none;">30919 </del>  48.85    0    <del style="font-weight: bold; text-decoration: none;">49525815</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   edge            <ins style="font-weight: bold; text-decoration: none;">1,013,801 </ins>1    2    7    32    <ins style="font-weight: bold; text-decoration: none;">30,919 </ins>  48.85    0    <ins style="font-weight: bold; text-decoration: none;">49,525,815</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  reads          47,092,950</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <del style="font-weight: bold; text-decoration: none;">    </del>min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">    </del>mean      n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <ins style="font-weight: bold; text-decoration: none;">    </ins>min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean      n50  sum</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   all            <del style="font-weight: bold; text-decoration: none;">20441 </del>  100  124  374  1980  <del style="font-weight: bold; text-decoration: none;">291000 </del> 2575.50  0    <del style="font-weight: bold; text-decoration: none;">52645707</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   all            <ins style="font-weight: bold; text-decoration: none;">20,441 </ins>  100  124  374  1980  <ins style="font-weight: bold; text-decoration: none;">291,000 </ins> 2575.50  0    <ins style="font-weight: bold; text-decoration: none;">52,645,707</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cE_coli        149 <del style="font-weight: bold; text-decoration: none;">    </del>100  325  6612  41908  <del style="font-weight: bold; text-decoration: none;">291000 </del> 30160.59  0    <del style="font-weight: bold; text-decoration: none;">4493928</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cE_coli        149 <ins style="font-weight: bold; text-decoration: none;">      </ins>100  325  6612  41908  <ins style="font-weight: bold; text-decoration: none;">291,000 </ins> 30160.59  0    <ins style="font-weight: bold; text-decoration: none;">4,493,928</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   cpFosDT5_2      0</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   cpFosDT5_2      0</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    58 <del style="font-weight: bold; text-decoration: none;">      </del>105  166  374  1950  <del style="font-weight: bold; text-decoration: none;">24932 </del>  1875.86  0    <del style="font-weight: bold; text-decoration: none;">108800</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    58 <ins style="font-weight: bold; text-decoration: none;">      </ins>105  166  374  1950  <ins style="font-weight: bold; text-decoration: none;">24,932 </ins>  1875.86  0    <ins style="font-weight: bold; text-decoration: none;">108,800</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <del style="font-weight: bold; text-decoration: none;">12294 </del>  100  141  785  4204  <del style="font-weight: bold; text-decoration: none;">45781 </del>  3513.34  0    <del style="font-weight: bold; text-decoration: none;">43192987</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <ins style="font-weight: bold; text-decoration: none;">12,294 </ins>  100  141  785  4204  <ins style="font-weight: bold; text-decoration: none;">45,781 </ins>  3513.34  0    <ins style="font-weight: bold; text-decoration: none;">43,192,987</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   other          7953 <del style="font-weight: bold; text-decoration: none;">    </del>100  113  171  599    <del style="font-weight: bold; text-decoration: none;">41416 </del>  619.60    0    <del style="font-weight: bold; text-decoration: none;">4927664</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   other          7953 <ins style="font-weight: bold; text-decoration: none;">    </ins>100  113  171  599    <ins style="font-weight: bold; text-decoration: none;">41,416 </ins>  619.60    0    <ins style="font-weight: bold; text-decoration: none;">4,927,664</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <del style="font-weight: bold; text-decoration: none;">  </del>min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">    </del>mean      n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <ins style="font-weight: bold; text-decoration: none;">    </ins>min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean      n50  sum</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   scf            <del style="font-weight: bold; text-decoration: none;">25482  </del>100  127  262  993    <del style="font-weight: bold; text-decoration: none;">239672 </del> 1339.89  0    <del style="font-weight: bold; text-decoration: none;">34143040</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   scf            <ins style="font-weight: bold; text-decoration: none;">25,482    </ins>100  127  262  993    <ins style="font-weight: bold; text-decoration: none;">239,672 </ins> 1339.89  0    <ins style="font-weight: bold; text-decoration: none;">34,143,040</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <del style="font-weight: bold; text-decoration: none;">265450  </del>32  34  50    121    <del style="font-weight: bold; text-decoration: none;">49599 </del>  143.69    0    <del style="font-weight: bold; text-decoration: none;">38141459</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <ins style="font-weight: bold; text-decoration: none;">265,450  </ins>32  34  50    121    <ins style="font-weight: bold; text-decoration: none;">49,599 </ins>  143.69    0    <ins style="font-weight: bold; text-decoration: none;">38,141,459</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   edge            <del style="font-weight: bold; text-decoration: none;">530926  </del>1    3    11    40    <del style="font-weight: bold; text-decoration: none;">41918 </del>  63.06    0    <del style="font-weight: bold; text-decoration: none;">33477999</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   edge            <ins style="font-weight: bold; text-decoration: none;">530,926  </ins>1    3    11    40    <ins style="font-weight: bold; text-decoration: none;">41,918 </ins>  63.06    0    <ins style="font-weight: bold; text-decoration: none;">33,477,999</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <del style="font-weight: bold; text-decoration: none;">  </del>min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">    </del>mean      n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <ins style="font-weight: bold; text-decoration: none;">    </ins>min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean      n50  sum</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   all            <del style="font-weight: bold; text-decoration: none;">25482  </del>100  127  262  993    <del style="font-weight: bold; text-decoration: none;">239672 </del> 1339.89  0    <del style="font-weight: bold; text-decoration: none;">34143040</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   all            <ins style="font-weight: bold; text-decoration: none;">25,482    </ins>100  127  262  993    <ins style="font-weight: bold; text-decoration: none;">239,672 </ins> 1339.89  0    <ins style="font-weight: bold; text-decoration: none;">34,143,040</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cE_coli        205 <del style="font-weight: bold; text-decoration: none;">    </del>100  252  2244  30571  <del style="font-weight: bold; text-decoration: none;">239672 </del> 21916.78  0    <del style="font-weight: bold; text-decoration: none;">4492939</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cE_coli        205 <ins style="font-weight: bold; text-decoration: none;">      </ins>100  252  2244  30571  <ins style="font-weight: bold; text-decoration: none;">239,672 </ins> 21916.78  0    <ins style="font-weight: bold; text-decoration: none;">4,492,939</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cpFosDT5_2      17 <del style="font-weight: bold; text-decoration: none;">    </del>100  118  171  272    855 <del style="font-weight: bold; text-decoration: none;">    </del>275.24    0    <del style="font-weight: bold; text-decoration: none;">4679</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cpFosDT5_2      17 <ins style="font-weight: bold; text-decoration: none;">      </ins>100  118  171  272    855 <ins style="font-weight: bold; text-decoration: none;">    </ins>275.24    0    <ins style="font-weight: bold; text-decoration: none;">4,679</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    31 <del style="font-weight: bold; text-decoration: none;">    </del>100  130  322  1363  <del style="font-weight: bold; text-decoration: none;">5717 </del>  986.52    0    <del style="font-weight: bold; text-decoration: none;">30582</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    31 <ins style="font-weight: bold; text-decoration: none;">      </ins>100  130  322  1363  <ins style="font-weight: bold; text-decoration: none;">5,717 </ins>  986.52    0    <ins style="font-weight: bold; text-decoration: none;">30,582</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <del style="font-weight: bold; text-decoration: none;">15668  </del>100  133  336  1529  <del style="font-weight: bold; text-decoration: none;">33075 </del>  1559.92  0    <del style="font-weight: bold; text-decoration: none;">24440863</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <ins style="font-weight: bold; text-decoration: none;">15,668    </ins>100  133  336  1529  <ins style="font-weight: bold; text-decoration: none;">33,075 </ins>  1559.92  0    <ins style="font-weight: bold; text-decoration: none;">24,440,863</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   other          <del style="font-weight: bold; text-decoration: none;">9574    </del>100  117  171  522    <del style="font-weight: bold; text-decoration: none;">27341 </del>  542.74    0    <del style="font-weight: bold; text-decoration: none;">5196233</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   other          <ins style="font-weight: bold; text-decoration: none;">9,574    </ins>100  117  171  522    <ins style="font-weight: bold; text-decoration: none;">27,341 </ins>  542.74    0    <ins style="font-weight: bold; text-decoration: none;">5,196,233</ins></div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8910&oldid=prev 2011-08-11T17:39:56Z

<p><span class="autocomment">SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:39, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l130">Line 130:</td> <td colspan="2" class="diff-lineno">Line 130:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">  </del>mean    n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean    n50  sum</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   all            <del style="font-weight: bold; text-decoration: none;">7859</del>* <del style="font-weight: bold; text-decoration: none;">    </del>100  113  139  284  <del style="font-weight: bold; text-decoration: none;">43079</del>* 331.49  .    <del style="font-weight: bold; text-decoration: none;">2605184</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   all            <ins style="font-weight: bold; text-decoration: none;">7,859</ins>* <ins style="font-weight: bold; text-decoration: none;">  </ins>100  113  139  284  <ins style="font-weight: bold; text-decoration: none;">43,079</ins>* 331.49  .    <ins style="font-weight: bold; text-decoration: none;">2,605,184</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    20        111  193  436  6140  <del style="font-weight: bold; text-decoration: none;">43079 </del> 5951.05  0    <del style="font-weight: bold; text-decoration: none;">119021</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    20        111  193  436  6140  <ins style="font-weight: bold; text-decoration: none;">43,079 </ins> 5951.05  0    <ins style="font-weight: bold; text-decoration: none;">119,021      # MUCH BETTER</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <del style="font-weight: bold; text-decoration: none;">5117      </del>100  114  141  320  <del style="font-weight: bold; text-decoration: none;">13733 </del> 334.94  0    <del style="font-weight: bold; text-decoration: none;">1713870</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <ins style="font-weight: bold; text-decoration: none;">5,117    </ins>100  114  141  320  <ins style="font-weight: bold; text-decoration: none;">13,733 </ins> 334.94  0    <ins style="font-weight: bold; text-decoration: none;">1,713,870</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   mito            8        101  134  685  1396  <del style="font-weight: bold; text-decoration: none;">2166 </del>  749.75  0    <del style="font-weight: bold; text-decoration: none;">5998 </del>      # VERY BAD</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   mito            8        101  134  685  1396  <ins style="font-weight: bold; text-decoration: none;">2,166 </ins>  749.75  0    <ins style="font-weight: bold; text-decoration: none;">5,998 </ins>      # VERY BAD</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   other          <del style="font-weight: bold; text-decoration: none;">2714      </del>100  111  133  226  <del style="font-weight: bold; text-decoration: none;">7353 </del>  282.35  0    <del style="font-weight: bold; text-decoration: none;">766295</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   other          <ins style="font-weight: bold; text-decoration: none;">2,714    </ins>100  111  133  226  <ins style="font-weight: bold; text-decoration: none;">7,353 </ins>  282.35  0    <ins style="font-weight: bold; text-decoration: none;">766,295</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==</div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8909&oldid=prev 2011-08-11T17:38:32Z

<p></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:38, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l92">Line 92:</td> <td colspan="2" class="diff-lineno">Line 92:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo&#039;s ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo&#039;s ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scaffold stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scaffold stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .                                elem <del style="font-weight: bold; text-decoration: none;">      </del>min    q1    q2    q3    max        mean      n50        sum  </div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .                                elem <ins style="font-weight: bold; text-decoration: none;">      </ins>min    q1    q2    q3    max        mean      n50        sum  </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d0  -max_rd_len100        <del style="font-weight: bold; text-decoration: none;">13747338  </del>100    100    100    100    <del style="font-weight: bold; text-decoration: none;">9185      </del>108.04    .          1,485,269,562</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d0  -max_rd_len100        <ins style="font-weight: bold; text-decoration: none;">13,747,338  </ins>100    100    100    100    <ins style="font-weight: bold; text-decoration: none;">9,185      </ins>108.04    .          1,485,269,562</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len72          <del style="font-weight: bold; text-decoration: none;">28934 </del>    100    111    136    426    <del style="font-weight: bold; text-decoration: none;">23376      </del>378.53*    0          10,952,507</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len72          <ins style="font-weight: bold; text-decoration: none;">28,934 </ins>    100    111    136    426    <ins style="font-weight: bold; text-decoration: none;">23,376    </ins>378.53*    0          10,952,507</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len100        <del style="font-weight: bold; text-decoration: none;">74820 </del>    100    105    125    390    <del style="font-weight: bold; text-decoration: none;">31673      </del>320.75    .          23,998,536   </div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len100        <ins style="font-weight: bold; text-decoration: none;">74,820 </ins>    100    105    125    390    <ins style="font-weight: bold; text-decoration: none;">31,673    </ins>320.75    .          23,998,536   </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len146        <del style="font-weight: bold; text-decoration: none;">224963 </del>    100    110    128    343    <del style="font-weight: bold; text-decoration: none;">23410      </del>260.64    .          58,635,190</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len146        <ins style="font-weight: bold; text-decoration: none;">224,963 </ins>    100    110    128    343    <ins style="font-weight: bold; text-decoration: none;">23,410    </ins>260.64    .          58,635,190</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d20 -max_rd_len100        <del style="font-weight: bold; text-decoration: none;">7859</del>*      100    113    139    284    <del style="font-weight: bold; text-decoration: none;">43079      </del>331.49    .          2,605,184             </div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d20 -max_rd_len100        <ins style="font-weight: bold; text-decoration: none;">7,859</ins>*      100    113    139    284    <ins style="font-weight: bold; text-decoration: none;">43,079    </ins>331.49    .          2,605,184             </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d48 -max_rd_len100        <del style="font-weight: bold; text-decoration: none;">3626 </del>      100    113    139    255    <del style="font-weight: bold; text-decoration: none;">43131</del>* <del style="font-weight: bold; text-decoration: none;">    </del>339.01    .          1,229,250</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d48 -max_rd_len100        <ins style="font-weight: bold; text-decoration: none;">3,626 </ins>      100    113    139    255    <ins style="font-weight: bold; text-decoration: none;">43,131</ins>* <ins style="font-weight: bold; text-decoration: none;">  </ins>339.01    .          1,229,250</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d0  -max_rd_len100        <del style="font-weight: bold; text-decoration: none;">211820 </del>    100    143    156*  187    <del style="font-weight: bold; text-decoration: none;">23273      </del>227.95    .          48,284,629</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d0  -max_rd_len100        <ins style="font-weight: bold; text-decoration: none;">211,820 </ins>    100    143    156*  187    <ins style="font-weight: bold; text-decoration: none;">23,273    </ins>227.95    .          48,284,629</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d2  -max_rd_len100        <del style="font-weight: bold; text-decoration: none;">61152 </del>    100    121    151    200    <del style="font-weight: bold; text-decoration: none;">30846      </del>286.05    0          17,492,450</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d2  -max_rd_len100        <ins style="font-weight: bold; text-decoration: none;">61,152 </ins>    100    121    151    200    <ins style="font-weight: bold; text-decoration: none;">30,846    </ins>286.05    0          17,492,450</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   .              elem        min  q1  q2    q3    max    mean    n50  sum          readOnContig</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   .              elem        min  q1  q2    q3    max    mean    n50  sum          readOnContig</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   scf            74,820      100  105  125  390  <del style="font-weight: bold; text-decoration: none;">31673  </del>320.75  0    23,998,536</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   scf            74,820      100  105  125  390  <ins style="font-weight: bold; text-decoration: none;">31,673 </ins>320.75  0    23,998,536</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            5,755,282  32  32  35    43    <del style="font-weight: bold; text-decoration: none;">7195  </del>41.63    0    239,620,204  33,083,609(40%)</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            5,755,282  32  32  35    43    <ins style="font-weight: bold; text-decoration: none;">7,195  </ins>41.63    0    239,620,204  33,083,609(40%)</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   edge            11,015,468  1    2    4    11    <del style="font-weight: bold; text-decoration: none;">7164  </del>8.75    0    96,380,983</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   edge            11,015,468  1    2    4    11    <ins style="font-weight: bold; text-decoration: none;">7,164  </ins>8.75    0    96,380,983</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   reads          82,283,738                                            6,006,712,874</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   reads          82,283,738                                            6,006,712,874</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">  </del>mean    n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean    n50  sum</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   all            <del style="font-weight: bold; text-decoration: none;">74820    </del>100  105  125  390  <del style="font-weight: bold; text-decoration: none;">31673 </del> 320.75  0    <del style="font-weight: bold; text-decoration: none;">23998536</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   all            <ins style="font-weight: bold; text-decoration: none;">74,820    </ins>100  105  125  390  <ins style="font-weight: bold; text-decoration: none;">31,673 </ins> 320.75  0    <ins style="font-weight: bold; text-decoration: none;">23,998,536</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    206      100  122  159  229  767 <del style="font-weight: bold; text-decoration: none;">  </del>191.56  0    <del style="font-weight: bold; text-decoration: none;">39462      </del># VERY BAD</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cChloroplast    206      100  122  159  229  767 <ins style="font-weight: bold; text-decoration: none;">    </ins>191.56  0    <ins style="font-weight: bold; text-decoration: none;">39,462      </ins># VERY BAD</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <del style="font-weight: bold; text-decoration: none;">10533    </del>100  113  143  428  <del style="font-weight: bold; text-decoration: none;">26589 </del> 477.68  0    <del style="font-weight: bold; text-decoration: none;">5031439</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   cBAC            <ins style="font-weight: bold; text-decoration: none;">10,533    </ins>100  113  143  428  <ins style="font-weight: bold; text-decoration: none;">26,589 </ins> 477.68  0    <ins style="font-weight: bold; text-decoration: none;">5,031,439</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   mito            83        105  448  1730  6851  <del style="font-weight: bold; text-decoration: none;">26364 </del> 4315.20  0    <del style="font-weight: bold; text-decoration: none;">358162</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   mito            83        105  448  1730  6851  <ins style="font-weight: bold; text-decoration: none;">26,364 </ins> 4315.20  0    <ins style="font-weight: bold; text-decoration: none;">358,162</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   other          <del style="font-weight: bold; text-decoration: none;">63998    </del>100  104  122  382  <del style="font-weight: bold; text-decoration: none;">31673 </del> 290.16  0    <del style="font-weight: bold; text-decoration: none;">18569473 </del>  # align to mito database ; Cycas_taitungensis was top hit</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   other          <ins style="font-weight: bold; text-decoration: none;">63,998    </ins>100  104  122  382  <ins style="font-weight: bold; text-decoration: none;">31,673 </ins> 290.16  0    <ins style="font-weight: bold; text-decoration: none;">18,569,473 </ins>  # align to mito database ; Cycas_taitungensis was top hit</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   other.long.hiGC 45        5066 6717 8233  10488 <del style="font-weight: bold; text-decoration: none;">31673 </del> 9662.07  0    <del style="font-weight: bold; text-decoration: none;">434793</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   other.long.hiGC 45        5066 6717 8233  10488 <ins style="font-weight: bold; text-decoration: none;">31,673 </ins> 9662.07  0    <ins style="font-weight: bold; text-decoration: none;">434,793</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max <del style="font-weight: bold; text-decoration: none;">  </del>mean    n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max <ins style="font-weight: bold; text-decoration: none;">    </ins>mean    n50  sum <ins style="font-weight: bold; text-decoration: none;">        readOnContig</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   scf            <del style="font-weight: bold; text-decoration: none;">7859      </del>100  113  139  284  <del style="font-weight: bold; text-decoration: none;">43079</del>* 331.49  .    <del style="font-weight: bold; text-decoration: none;">2605184</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   scf            <ins style="font-weight: bold; text-decoration: none;">7,859    </ins>100  113  139  284  <ins style="font-weight: bold; text-decoration: none;">43,079</ins>* 331.49  .    <ins style="font-weight: bold; text-decoration: none;">2,605,184</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <del style="font-weight: bold; text-decoration: none;">200062    </del>32  33  37    47    <del style="font-weight: bold; text-decoration: none;">10392 </del> 48.52    .    <del style="font-weight: bold; text-decoration: none;">9707307</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <ins style="font-weight: bold; text-decoration: none;">200,062  </ins>32  33  37    47    <ins style="font-weight: bold; text-decoration: none;">10,392 </ins> 48.52    .    <ins style="font-weight: bold; text-decoration: none;">9,707,307    19,002,331(23%)</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  reads          82,283,738</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8908&oldid=prev 2011-08-11T17:33:14Z

<p><span class="autocomment">SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:33, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l107">Line 107:</td> <td colspan="2" class="diff-lineno">Line 107:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <del style="font-weight: bold; text-decoration: none;">    </del>min  q1  q2    q3    max    mean    n50  sum <del style="font-weight: bold; text-decoration: none;">      </del>readOnContig</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem <ins style="font-weight: bold; text-decoration: none;">      </ins>min  q1  q2    q3    max    mean    n50  sum <ins style="font-weight: bold; text-decoration: none;">          </ins>readOnContig</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   scf            <del style="font-weight: bold; text-decoration: none;">74820    </del>100  105  125  390  31673  320.75  0    <del style="font-weight: bold; text-decoration: none;">23998536</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   scf            <ins style="font-weight: bold; text-decoration: none;">74,820      </ins>100  105  125  390  31673  320.75  0    <ins style="font-weight: bold; text-decoration: none;">23,998,536</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <del style="font-weight: bold; text-decoration: none;">5755282 </del>  32  32  35    43    7195  41.63    0    <del style="font-weight: bold; text-decoration: none;">239620204  </del>33,083,609</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            <ins style="font-weight: bold; text-decoration: none;">5,755,282 </ins>  32  32  35    43    7195  41.63    0    <ins style="font-weight: bold; text-decoration: none;">239,620,204  </ins>33,083,609<ins style="font-weight: bold; text-decoration: none;">(40%)</ins></div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   edge            <del style="font-weight: bold; text-decoration: none;">11015468 </del> 1    2    4    11    7164  8.75    0    <del style="font-weight: bold; text-decoration: none;">96380983</del></div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   edge            <ins style="font-weight: bold; text-decoration: none;">11,015,468 </ins> 1    2    4    11    7164  8.75    0    <ins style="font-weight: bold; text-decoration: none;">96,380,983</ins></div></td></tr> <tr><td colspan="2" class="diff-side-deleted"></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  reads          82,283,738                                            6,006,712,874</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #scf alignments</div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8907&oldid=prev 2011-08-11T17:29:41Z

<p><span class="autocomment">SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:29, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l107">Line 107:</td> <td colspan="2" class="diff-lineno">Line 107:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   #stats</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max    mean    n50  sum</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   .              elem      min  q1  q2    q3    max    mean    n50  sum <ins style="font-weight: bold; text-decoration: none;">      readOnContig</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   scf            74820    100  105  125  390  31673  320.75  0    23998536</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   scf            74820    100  105  125  390  31673  320.75  0    23998536</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   ctg            5755282  32  32  35    43    7195  41.63    0    239620204</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   ctg            5755282  32  32  35    43    7195  41.63    0    239620204 <ins style="font-weight: bold; text-decoration: none;"> 33,083,609</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   edge            11015468  1    2    4    11    7164  8.75    0    96380983</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   edge            11015468  1    2    4    11    7164  8.75    0    96380983</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8906&oldid=prev 2011-08-11T17:28:45Z

<p><span class="autocomment">SOAPdenovo&#039;s</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:28, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l95">Line 95:</td> <td colspan="2" class="diff-lineno">Line 95:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d0  -max_rd_len100        13747338  100    100    100    100    9185      108.04    .          1,485,269,562</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d0  -max_rd_len100        13747338  100    100    100    100    9185      108.04    .          1,485,269,562</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len72  </div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len72 <ins style="font-weight: bold; text-decoration: none;">        28934      100    111    136    426    23376      378.53*    0          10,952,507</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len100        74820      100    105    125    390    31673      320.75    .          23,998,536   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len100        74820      100    105    125    390    31673      320.75    .          23,998,536   </div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len146        224963    100    110    128    343    23410      260.64    .          58,635,190</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d2  -max_rd_len146        224963    100    110    128    343    23410      260.64    .          58,635,190</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d20 -max_rd_len100        7859*      100    113    139    284    43079      331.49    .          2,605,184             </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d20 -max_rd_len100        7859*      100    113    139    284    43079      331.49    .          2,605,184             </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d48 -max_rd_len100        3626      100    113    139    255    43131 <del style="font-weight: bold; text-decoration: none;">    </del>339.01    .          1,229,250</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K31 -d48 -max_rd_len100        3626      100    113    139    255    43131<ins style="font-weight: bold; text-decoration: none;">*    </ins>339.01    .          1,229,250</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d0  -max_rd_len100        211820    100    143    156*  187    23273      227.95    .          48,284,629</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d0  -max_rd_len100        211820    100    143    156*  187    23273      227.95    .          48,284,629</div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d2  -max_rd_len100</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   -K47 -d2  -max_rd_len100 <ins style="font-weight: bold; text-decoration: none;">        61152      100    121    151    200    30846      286.05    0          17,492,450</ins></div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==</div></td></tr> </table>

Dpuiu https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pine_tree&diff=8905&oldid=prev 2011-08-11T17:22:31Z

<p><span class="autocomment">Reads (Drosophila)</span></p> <table style="background-color: #fff; color: #202122;" data-mw="interface"> <col class="diff-marker" /> <col class="diff-content" /> <col class="diff-marker" /> <col class="diff-content" /> <tr class="diff-title" lang="en"> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">← Older revision</td> <td colspan="2" style="background-color: #fff; color: #202122; text-align: center;">Revision as of 17:22, 11 August 2011</td> </tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l164">Line 164:</td> <td colspan="2" class="diff-lineno">Line 164:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   total          137,586,636    ?    # actually the chromosome lengths sum to 130,450,100</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   total          137,586,636    ?    # actually the chromosome lengths sum to 130,450,100</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>== Reads <del style="font-weight: bold; text-decoration: none;">(Drosophila) </del>==     </div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>== Reads ==     </div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   lib                      readLen  #reads    #cE_coli        #pFosDT5_2      #cChloroplast  #cBAC   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   lib                      readLen  #reads    #cE_coli        #pFosDT5_2      #cChloroplast  #cBAC   </div></td></tr> <tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l170">Line 170:</td> <td colspan="2" class="diff-lineno">Line 170:</td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   FC70M6V_6_001_2          156      23546475  2885406(12.25%)  5854468(24.86%)  21794(0.09%)  7520343(31.93%)</div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   FC70M6V_6_001_2          156      23546475  2885406(12.25%)  5854468(24.86%)  21794(0.09%)  7520343(31.93%)</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><br></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   lib                      readLen  #mates    mea,std  ~gc%  %merged(Tanja) <del style="font-weight: bold; text-decoration: none;">  </del>%cE_coli <del style="font-weight: bold; text-decoration: none;"> </del>%cpFosDT5_2  %<del style="font-weight: bold; text-decoration: none;">cChloroplast </del> %<del style="font-weight: bold; text-decoration: none;">cBAC  </del>%other   </div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   lib                      readLen  #mates    mea,std  ~gc%  %merged(Tanja) %cE_coli %cpFosDT5_2 <ins style="font-weight: bold; text-decoration: none;">%cChloro </ins> %<ins style="font-weight: bold; text-decoration: none;">cBAC </ins> %<ins style="font-weight: bold; text-decoration: none;">pBAC-DE </ins>%other   </div></td></tr> <tr><td class="diff-marker" data-marker="−"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   FC70M6V_6_001            160,156  23546475  343,30    42.5 <del style="font-weight: bold; text-decoration: none;">                  </del>12.5% <del style="font-weight: bold; text-decoration: none;">    </del>24% <del style="font-weight: bold; text-decoration: none;">        </del>0.09% <del style="font-weight: bold; text-decoration: none;">        </del>32.5 <del style="font-weight: bold; text-decoration: none;">  34      </del># sampled 100K</div></td><td class="diff-marker" data-marker="+"></td><td style="color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   FC70M6V_6_001            160,156  23546475  343,30    42.5 <ins style="font-weight: bold; text-decoration: none;">                </ins>12.5% <ins style="font-weight: bold; text-decoration: none;">  </ins>24% <ins style="font-weight: bold; text-decoration: none;">        </ins>0.09% <ins style="font-weight: bold; text-decoration: none;">    </ins>32.5 <ins style="font-weight: bold; text-decoration: none;">  19.3          </ins># sampled 100K</div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   </div></td></tr> <tr><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   TIL_242_FC70M6V_2_002    160,156  9917211  242      .      91.4%   </div></td><td class="diff-marker"></td><td style="background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;"><div>   TIL_242_FC70M6V_2_002    160,156  9917211  242      .      91.4%   </div></td></tr> </table>

Dpuiu