Pseudodomonas syringae: Difference between revisions

From Cbcb
Jump to navigation Jump to search
Line 102: Line 102:
[[Media:Ps.Solexa.cvg.qc.combine|qc stats for Solexa assemblies done at different coverage levels]]  
[[Media:Ps.Solexa.cvg.qc.combine|qc stats for Solexa assemblies done at different coverage levels]]  
   cvg: 30,27,24...3
   cvg: 30,27,24...3
  contig.summary
  ::::::::::::::
  %reads  #elem  #elem0  #elem<0 min    median  max    sum    mean    stdev  n50
  100    5502    0      0      32      338    32148  7296600 1326.17 2157.6  3714
  90      6463    0      0      32      330    25252  7252304 1122.13 1799.43 3009
  80      7570    0      0      32      303    20690  7209479 952.38  1487.03 2573
  70      9030    0      0      32      309    26306  7170384 794.06  1219.53 1986
  60      10571  0      0      32      295    22249  7124996 674.01  961.22  1608
  50      12598  0      0      32      274    22204  7075934 561.67  767.55  1266
  40      15343  0      0      32      252    9176    7011485 456.98  575.64  934
  30      21248  0      0      32      202    7751    6931907 326.24  376.06  597
  20      38702  0      0      32      117    3276    6807914 175.91  178.92  278
  10      84545  0      0      32      56      2652    6267925 74.14  57.62  90
  ::::::::::::::
  positiveGaps.summary
  ::::::::::::::
  %reads  #elem  #elem0  #elem<0 min    median  max    sum    mean    stdev  n50
  100    117    10      0      0      22      3065    19625  167.74  418.75  1308
  90      130    16      0      0      19      2100    19725  151.73  369.07  1211
  80      142    18      0      0      15      2174    20034  141.08  361.86  1209
  70      178    15      0      0      9      3417    20443  114.85  395.13  1823
  60      263    35      0      0      6      3875    21161  80.46  345.97  1457
  50      450    64      0      0      4      3398    22305  49.57  278.39  1823
  40      1047    156    0      0      4      3398    26488  25.3    173.77  929
  30      2915    446    0      0      4      3426    39094  13.41  115.74  104
  20      11154  1324    0      0      5      3420    110485  9.91    57.22  19
  10      44751  3321    0      0      9      3875    631930  14.12  35.45  25

Revision as of 19:29, 27 November 2007

Pseudomonas syringae pv. tomato str. DC3000

Originally sequenced and finished at TIGR: published Sept 2003

NCBI:

 AA: no assembly
 TA 80,959 reads 
 Genome Project
 Taxonomy TaxId=223283

UNC:

New sequence:

 * Solexa 3 lanes; 
 * 454 shotgun 1/4 Plate (250bp read); 
 * 454 paired ends 1/4 Plate : 
     * contain a 44 bp linker in the middle
     * the linker sequence is: GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
     * there are some (not many) 454 paired end sequences that contain multiple instances of the linker (tandem): Example EUEIEUN01ANUGL_length=128_xy=0154_1891 

UNC sequence data:

 http://biology622.dhcp.unc.edu/~labweb/DCData/

UNC assembly:

 * Theoretical minimum number of contigs we can obtain is 268 (our reads fail to cover 269 nucleotides). 
 * Our de novo assembly spans the genome in 853 contigs totaling 6,313,026 bp. 
 * 98.7% of the genome is covered by a contig; 
 * 84% of the genome is covered by contigs 10,000 bp or greater. 
 * The average gap size between contigs is 98 bp; 
 * average contig size 7401 bp. 
 * The N50 = 37,444 bp. 
 * Our largest BAMBUS "scaffold" is 2,565,761 bp,

Data stats

 .                               #elem           min     median  max     sum             mean    stdev   n50
 DC3000.format.454Reads.fna      123992          38      86      329     15623908        126.01  58.89   142     DC3000 Paired End Reads
 DC3000.TCA.454reads.format.fna  77466           35      244     371     18627363        240.46  26.85   245     DC3000 454 Reads
 DC3000.reads.filtered.fasta     6340136         32      32      32      202884352       32      0       32      DC3000 Solexa Reads
 DC3000Plasmids.fa               2               67473   73661   73661   141134          70567   3094    73661   Pseudomonas syringae pv. tomato DC3000 Plasmids
 Psudomonas_syringae.fa          1               6397126 6397126 6397126 6397126         6397126 0       6397126 Pseudomonas syringae pv. tomato DC3000 reference

Files location:

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Data
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly

Best CBCB assemblies:

1. AMOSCmp

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454/2007_1009_AMOSCmp-relaxed
 142 contigs (37 negative gaps)
 based on the mix of 454 single reads + Solexa reads (no 454 paired ends) 
 No read trimming was done. 
 AMOScmp used the following parameters:
   nucmer -c  20
   casm-layout -t 20 -o 5
 "-t 20" allows for 20 bp long  dirty sequence ends which seem to solve the "low quality" problem.
 22 large contigs

2. AMOSCmp

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454/2007_1015_AMOSCmp-relaxed-MAJORITY50 
 131 contigs  (18 negative gaps)
 based on the mix of 454 single reads + Solexa reads (no 454 paired ends) 
 No read trimming was done. 
 AMOScmp used the following parameters:
   nucmer -c  20
   casm-layout -t 20 -o 5 -m 50
 No read trimming was done. 
 "-t 20" allows for 20 bp long  dirty sequence ends which seem to solve the "low quality" problem.
 "-m 20" merges some contigs together
 10 large contigs
 contig#        len     gc%
 4              2290968 59.00
 7              1817904 58.18
 3              1405326 58.08
 5              648413  58.48
 2              192413  57.86
 6              87152   58.02
 131            71251   56.47
 1              32939   54.86
 130            29120   59.36
 9              20309   53.56
 95             3589    59.46

3. AMOSCmp of Sanger reads

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_AMOSCmp-relaxed
 Many miss-oriented mates in the 4.8M-5M region of the chromosome

4. Celera 3.11 of Sanger reads

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_WGA
 Scaffold 7180000001443 looks circular: possible 163,074 bp plasmid

5. AMOSCmp of Sanger reads

 Reference=complete genome(chromosome+3 plasmids) + "circular contig" in Celera 3.11 assembly
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids
 38 contigs: 15 for main chromosome, 1 for longer plasmid, 21 for shorter plasmid, 1 for "circular contig"
 The missoriented read pile corresponding to the chromosome (3. AMOSCmp of Sanger reads) has dissapeared
 AA ready for submission: /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids/AA/umd-20071030-141700.tar.gz

Solexa assemblied for different read coverages

qc stats for Solexa assemblies done at different coverage levels

 cvg: 30,27,24...3


 contig.summary
 ::::::::::::::
 %reads  #elem   #elem0  #elem<0 min     median  max     sum     mean    stdev   n50
 100     5502    0       0       32      338     32148   7296600 1326.17 2157.6  3714
 90      6463    0       0       32      330     25252   7252304 1122.13 1799.43 3009
 80      7570    0       0       32      303     20690   7209479 952.38  1487.03 2573
 70      9030    0       0       32      309     26306   7170384 794.06  1219.53 1986
 60      10571   0       0       32      295     22249   7124996 674.01  961.22  1608
 50      12598   0       0       32      274     22204   7075934 561.67  767.55  1266
 40      15343   0       0       32      252     9176    7011485 456.98  575.64  934
 30      21248   0       0       32      202     7751    6931907 326.24  376.06  597
 20      38702   0       0       32      117     3276    6807914 175.91  178.92  278
 10      84545   0       0       32      56      2652    6267925 74.14   57.62   90
 ::::::::::::::
 positiveGaps.summary
 ::::::::::::::
 %reads  #elem   #elem0  #elem<0 min     median  max     sum     mean    stdev   n50
 100     117     10      0       0       22      3065    19625   167.74  418.75  1308
 90      130     16      0       0       19      2100    19725   151.73  369.07  1211
 80      142     18      0       0       15      2174    20034   141.08  361.86  1209
 70      178     15      0       0       9       3417    20443   114.85  395.13  1823
 60      263     35      0       0       6       3875    21161   80.46   345.97  1457
 50      450     64      0       0       4       3398    22305   49.57   278.39  1823
 40      1047    156     0       0       4       3398    26488   25.3    173.77  929
 30      2915    446     0       0       4       3426    39094   13.41   115.74  104
 20      11154   1324    0       0       5       3420    110485  9.91    57.22   19
 10      44751   3321    0       0       9       3875    631930  14.12   35.45   25