Pseudodomonas syringae: Difference between revisions

From Cbcb
Jump to navigation Jump to search
Line 170: Line 170:


Location
Location
   /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa/sample/
   /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/sample/
    
    
   Several AMOScmp assemblies, using 100%, 90% ... 10% of the P. syringae Solexa reads.  
   Several AMOScmp assemblies, using 10%,20%, ... 100%, of the P. syringae Solexa reads.  
   These would correspond to 30X, 27X, 24X .. 3X coverage  
   These would correspond to 3X,6X ... 30X, coverage  
   The read sampling was done randomly. One sample set for each coverage.
   The read sampling was done randomly. One sample set for each coverage.
   
   
----
   all contigs
 
   desc    #elem  min    max    mean         stdev           sum
   <span style="color:red">
   10   43136   32      7712   135.11          140.61          5828148
   The contig sequences were generated using AMOS bank2fasta. EMBOSS infoseq was used to get contig lengths.
   20   11243   32      20190   570.01         686.5          6408705
  The positive gap sizes (bases not covered) were taken from the .scaff file.
   30    2972    32      27962   2185.32        2804.56        6494784
  ~dpuiu/bin/getSummary.pl was used to compute contig/gap summaries(mean/max/sum ...)
   40    1058   32      63125   6152.98        7871.7          6509855
  </span>
   50   455     32     163430 14319.01        19663.15       6515153
 
   60    267     32     328882 24406.61        46172.62        6516567
'''Chromosome + 2 plasmids'''
   70   166     32     671064 39260.9         84200.42        6517311
 
   80    143     32      906652 45577.16        111875.19       6517535
[[Media:Ps.Solexa.cvg.qc.combine|qc stats for Solexa assemblies done at different coverage levels]]
   90   117    32      1433643 55708.4        164246.61       6517883
  cvg: 30,27,24...3
   100  106     32     2067205 61489.83        230284.47       6517923
   
  $ more contig.chromo.summary positiveGaps.chromo.summary
  ::::::::::::::
  contig.summary
  ::::::::::::::
  %reads  #elem  #elem0  #elem<0 min    median  max     sum     mean   stdev   n50
   100    5502   0      0      32      338    32148   7296600 1326.17 2157.6  3714
  90      6463    0      0      32      330    25252  7252304 1122.13 1799.43 3009
  80      7570   0      0      32      303    20690  7209479 952.38  1487.03 2573
   70      9030   0      0      32      309    26306  7170384 794.06  1219.53 1986
  60      10571   0      0      32      295    22249   7124996 674.01 961.22  1608
   50      12598  0      0      32      274    22204   7075934 561.67  767.55  1266
   40     15343  0      0      32      252    9176   7011485 456.98  575.64  934
  30      21248  0      0      32      202    7751   6931907 326.24  376.06  597
  20      38702  0      0      32      117    3276    6807914 175.91  178.92  278
  10      84545   0      0      32      56      2652    6267925 74.14  57.62  90
   ::::::::::::::
  positiveGaps.summary
  ::::::::::::::
  %reads  #elem  #elem0  #elem<0 min    median  max    sum    mean   stdev  n50
  100     117    10     0      0      22      3065    19625  167.74 418.75  1308
  90      130    16      0      0      19      2100    19725  151.73  369.07  1211
  80      142    18      0      0      15     2174    20034  141.08  361.86  1209
  70      178    15      0      0      9      3417    20443  114.85  395.13  1823
   60     263    35      0      0      6      3875   21161  80.46  345.97  1457
  50      450     64     0      0      4      3398    22305  49.57  278.39 1823
  40      1047    156    0      0      4      3398    26488  25.3    173.77  929
   30      2915   446     0      0      4      3426    39094  13.41  115.74  104
  20     11154  1324    0      0      5      3420    110485 9.91    57.22  19
  10      44751  3321    0      0      9       3875    631930  14.12  35.45  25
 
'''Chromosome (only)'''
 
  $ more contig.chromo.summary positiveGaps.chromo.summary
  ::::::::::::::
  contig.chromo.summary
  ::::::::::::::
  %reads  #elem  #elem0  #elem<0 min    median  max    sum    mean    stdev  n50
  100    5352    0      0      32      387    18942  7152892 1336.49 2069.25 3674
  90      6313    0      0      32      362    16470  7110882 1126.39 1721.34 2969
   80     7411   0      0      32      322     15227  7069778 953.96  1436.49 2521
  70      8865    0      0      32      324    14901  7032202 793.25 1154.9  1968
  60      10406  0      0      32      304    10231  6988498 671.58  919.5  1586
  50      12389  0       0      32      279    7246    6941706 560.31  733.75  1247
   40      15131  0      0      32      256    5409   6879810 454.68  554.17  920
  30      20998  0      0      32      204    4102    6801160 323.9  358.93  588
  20      38368  0      0      32      117    2220    6680303 174.11  170.14  274
  10      83839  0      0      32      56      762    6144687 73.29  51.16  89
  ::::::::::::::
  positiveGaps.chromo.summary
  ::::::::::::::
  .      #elem  #elem0  #elem<0 min    median  max    sum    mean    stdev  n50
   100     15      5      0      0      1      33      107    7.13    10.84  33
   90      24      7      0      0      2      42      146     6.08    10.38  42
  80      38      11      0      0      2      36     212    5.58    8.84    26
  70      76      11      0      0      3       33      413    5.43    6.66    11
  60      163    29      0      0      4      33      1016    6.23    7.04    13
  50      347    60      0      0      3      49      1843    5.31    6.45    11
  40      947    151    0      0      4      53      5709    6.03    7.18    12
  30      2819    442    0      0      4      63      17882  6.34    7.34    12
  20      11029  1320    0      0      5      610    88516  8.03    10.84  15
  10      44485  3313    0      0      9      197    606841  13.64  15.05  24
 
----
 
  <span style="color:red">
  Nucmer was used to align contigs to reference
  "~dpuiu/bin/getNucmerCoverage.pl -M 0" was used to identify the 0 cvg regions
  </span>
 
'''Chromosome + 2 plasmids'''
    
    
   '''Table.? Gap sizes in P. syringae main chromosome & 2 plasmids for different Solexa assemblies'''
   chromo contigs
  desc    #elem  min    max    mean          stdev          sum
  10    42845  32      1845    133.32          118.36          5712348
  20    11124  32      9650    565.41          625.32          6289649
  30    2876    32      26076  2216.64        2714.92        6375063
  40    965    32      63125  6621.71        7893.19        6389957
  50    362    32      163430  17665.19        20565.31        6394800
  60    167    32      328882  38299.32        53660.75        6395987
  70    75      257    671064  85287.52        108858.19      6396564
  80    49      940    906652  130546.42      160470.1        6396775
  90    25      42603  1433643 255877.72      277650.54      6396943
  100  18      42603  2067205 355387.77      465907.88      6396980
    
    
   $ more Solexa.coords.0cvg.summary
   all gaps
   %reads  #elem  #elem0  #elem<0 min    median  max     sum     mean    stdev  n50
   desc    #elem  min    max    mean    stdev  sum
   100    104    0      0      1      62      1179   15804   151.96  236.77  486
   10    43137  1      3874   16.46   38.01  710112
   90      108    0      0      1      54      1697   15896   147.19  261.28  486
   20    11242  1      3919   11.52   64.43  129555
   80      117    0      0      1      35      1697   16057   137.24 253.9  486
   30    2971    1      3418   14.63   114.29 43476
   70      151    0      0      1      17      1697   16240   107.55  230.46  490
   40    1056    1      3873   26.89   196.7  28405
   60      223     0      0      1      10      1189   16872  75.66   177.66 455
   50    454     1      3415   50.89   291.04 23107
   50      371     0      0      1      6      1703   17841   48.09   155.85  445
   60    265     1      3870   81.86   380.9   21693
   40      888     0      0      1      5      1703   21504  24.22  104.94 296
   70    165     1      3868   126.96  486.88 20949
   30      2539   0      0      1      5      1697   33875  13.34  63.75  36
   80   141    1      3414   146.98  461.06  20725
   20      10198  0      0      1      6      1709   104225 10.22  33.56  17
   90    115    1      3418   177.19 520.11  20377
   10      42284   0      0      1      10      1711   619965 14.66  21.88  24
   100   104    1      3278   195.54 511.06  20337
 
'''Chromosome (only)'''
 
  '''Table.? Gap sizes in P. syringae main chromosome for different Solexa assemblies'''
    
    
   $ more Solexa.coords.0cvg.chromo.summary
   chromo gaps
   %reads  #elem  #elem0  #elem<0 min    median  max     sum     mean    stdev  n50
   desc    #elem  min    max    mean    stdev  sum
   100    6      0      0      1      17      33      94      15.67   12.85   33
   10    42846  1      240    15.98   16.33   684778
   90      11      0      0      1      6      42      132    12      13.02   42
   20    11125   1      146     9.66   9.72    107477
  80      21      0      0      1      6      35      199     9.48   10.38  26
   30    2876    1      76     7.67    7.73   22063
   70      54      0      0      1      4      33     367    6.8    7.19   14
   40    965     1      58     7.42   7.8    7169
   60      124     0      0      1      5      33     922    7.44   7.36    13
   50   362     1      48     6.42   7.08   2326
   50     269     0      0      1      4      49     1768    6.57   6.68   11
   60    167     1      58     6.82   7.63   1139
   40      780     0      0      1      5      53     5428    6.96   7.08   11
   70    76     1      55     7.39   7.9    562
   30     2432    0      0      1      5      63     17447  7.17   7.19    12
   80    49     1      55      7.16   10.08  351
   20     10078  0      0      1      6      150    87195  8.65   8.97    14
   90    25     1      45     7.31   10.12   183
   10     42115  0      0      1      10     197    601641  14.29  14.7   24
   100   18      1       55      8.11   13.62   146
 
  => six 0 cvg regions in the chromosome if 100% of Solexa reads are used
 
Regions:
 
  Ref                            start  end
  gi|28867243|ref|NC_004578.1|   1022626 1022643 0
  gi|28867243|ref|NC_004578.1|    1206959 1206992 0 # near a transposease
   gi|28867243|ref|NC_004578.1|    3000373 3000405 0
   gi|28867243|ref|NC_004578.1|    3402234 3402240 0
   gi|28867243|ref|NC_004578.1|    3496311 3496312 0
  gi|28867243|ref|NC_004578.1|   4711568 4711573 0
 
  $ extractseq chromo.1con -regions '1022626-1022643,1206959-1206992,3000373-3000405,3402234-3402240,3496311-3496312,4711568-4711573' stdout -separate | awk '{print $1}'
 
  >NC_004578.1_1022626_1022643
  GGGGTTTTTATTGGGGCT
 
  >NC_004578.1_1206959_1206992  # near a transposease
  TAGAGATATTTTCAATACTAAAAAATATATTTTC
 
  >NC_004578.1_3000373_3000405
  GGCGCGACAGGCTTCCAGACGAGGTCTGCACGC
 
  >NC_004578.1_3402234_3402240
   CGGCTAC
 
  >NC_004578.1_3496311_3496312
  GA
 
  >NC_004578.1_4711568_4711573
  TGCCCG
 


=== CBCB (new) ===
=== CBCB (new) ===

Revision as of 17:32, 20 February 2008

Pseudomonas syringae pv. tomato str. DC3000


Data

Originally sequenced and finished at TIGR: published Sept 2003

NCBI

 AA: no assembly
 TA 80,959 reads 
 Genome Project
 Taxonomy TaxId=223283

Chromosome + 2 plasmids: 

 Name           Length    %GC    Info
 NC_004578.1    6,397,126 58.40  chromosome
 NC_004633.1    73,661    55.15  plasmid pDC3000A
 NC_004632.1    67,473    56.17  plasmid pDC3000B
 total          6,538,260

 Little similarity between the chromosome and plasmids.
 The 2 plasmids share a significant amount of DNA; see /fs/szasmg2/Bacteria/Pseudomonas_syringae/Data/nucmer/NC_004633-NC_004632.png

UNC: Jeff Dangl

New sequence:

Read stats 

 Type   File                            #reads            min     median  max     sum             mean    stdev   n50
 Solexa DC3000.reads.filtered.fasta     6,340,136         32      32      32      202884352       32      0       32
 454p   DC3000.format.454Reads.fna      123,992           38      86      329     15623908        126.01  58.89   142
 454    DC3000.TCA.454reads.format.fna  77,466            35      244     371     18627363        240.46  26.85   245 

 * Solexa 3 lanes; 
 * 454 shotgun 1/4 Plate (250bp read); 
 * 454 paired ends 1/4 Plate : 
     * contain a 44 bp linker in the middle
     * the linker sequence is: GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
     * there are some (not many) 454 paired end sequences that contain multiple instances of the linker (tandem): Example EUEIEUN01ANUGL_length=128_xy=0154_1891 
 
 
 Quality values are missing for all data sets!!!
 I assigned default qual=3 to all the base (.frg & .afg files)

UNC sequence data: (not avail any more?) 

 http://biology622.dhcp.unc.edu/~labweb/DCData/

UNC (e-mail): 

 * Theoretical minimum number of contigs we can obtain is 268 (our reads fail to cover 269 nucleotides). 
 * Our de novo assembly spans the genome in 853 contigs totaling 6,313,026 bp. 
 * 98.7% of the genome is covered by a contig; 
 * 84% of the genome is covered by contigs 10,000 bp or greater. 
 * The average gap size between contigs is 98 bp; 
 * average contig size 7401 bp. 
 * The N50 = 37,444 bp. 
 * Our largest BAMBUS "scaffold" is 2,565,761 bp

Files location: 

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Data
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly

Assemblies

CBCB (old)

!!! All AMOSCmp assemblies contain tandem duplications in Solexa only coverage areas

1. AMOSCmp 

 454 single reads + Solexa reads 
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454/2007_1009_AMOSCmp-relaxed
 142 contigs (37 negative gaps, 89 positive gaps)
 No read trimming was done. 
 AMOScmp used the following parameters:
   nucmer -c  20
   casm-layout -t 20 -o 5
 "-t 20" allows for 20 bp long  dirty sequence ends which seem to solve the "low quality" problem.
 => 22 large contigs
 
 454 single reads + 30 bp Solexa reads  => 167 contigs , 49 negative gaps, 100 positive gaps 
 454 single reads + 25 bp Solexa reads  => 293 contigs,  144 negative gaps, 131 positive gaps

2. AMOSCmp 

 454 single reads + Solexa reads + 454 paired ends
 Only the 454 paired ends that contain 1 single complete adaptor sequence were used (allmost all)
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454-454p/2007_1011_AMOSCmp-relaxed-filtered
 149 contigs; very similar to the prev ome

3. AMOSCmp (MAJORITY=50) -> best 

 454 single reads + Solexa reads 
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454/2007_1015_AMOSCmp-relaxed-MAJORITY50 
 131 contigs  (18 negative gaps)
 No read trimming was done. 
 AMOScmp used the following parameters:
   nucmer -c  20
   casm-layout -t 20 -o 5 -m 50
 No read trimming was done. 
 "-t 20" allows for 20 bp long  dirty sequence ends which seem to solve the "low quality" problem.
 "-m 20" merges some contigs together
 => 10 large contigs

 contig#        len     gc%
 4              2290968 59.00
 7              1817904 58.18
 3              1405326 58.08
 5              648413  58.48
 2              192413  57.86
 6              87152   58.02
 131            71251   56.47
 1              32939   54.86
 130            29120   59.36
 9              20309   53.56
 95             3589    59.46



 Rerun Solexa32,Solexa30,Solexa25 with "nucmer -b 2 -g 5"
 
 2007_1015_AMOSCmp-relaxed-Solexa32/
 2007_1015_AMOSCmp-relaxed-Solexa30/
 2007_1015_AMOSCmp-relaxed-Solexa25/
 /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa-454/qc.combine.3
 
 $ show-coords 1con-contigs.delta | grep gi | awk '{print $7}' | getSummary.pl # sum of ref alignments: 13608985
 $ show-coords 1con-contigs.delta | grep gi | awk '{print $8}' | getSummary.pl # sum of qry alignments: 13747738
  138,753 bp in duplications for Solexa32 ??? 
   61,741 bp in duplications for Solexa30 ??? 
   10,881 bp in duplications for Solexa25 ??? 

 Copy of assembly files:
  /fs/ftp-cbcb/pub/data/dpuiu/Pseudomonas_syringae
  ftp://ftp.cbcb.umd.edu/pub/data/dpuiu/Pseudomonas_syringae/Solexa-454

4. AMOSCmp 

 Sanger reads
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_AMOSCmp-relaxed
 Many miss-oriented mates in the 4.8M-5M region of the chromosome
 22 contigs
 Chromosome
 Chromosome problem

5. Celera 3.11 

 Sanger reads
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_WGA
 22 scaff, 46 contigs, 181 degens
 Scaffold 7180000001443 looks circular: possible 163,074 bp plasmid
 aligns to 4.8M-5M "problem" region in the chromosome
 7180000001443.png

     [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [% IDY]  |  [LEN R]  [LEN Q]  |  [COV R]  [COV Q]  | [TAGS]
 ===============================================================================================================================
        1   175592  |        1   175592  |   175592   175592  |   100.00  |   175592   175592  |   100.00   100.00  | 7180000001443   7180000001443   [IDENTITY]
        1    12519  |   163075   175592  |    12519    12518  |    99.98  |   175592   175592  |     7.13     7.13  | 7180000001443   7180000001443   [BEGIN]
   163075   175592  |        1    12519  |    12518    12519  |    99.98  |   175592   175592  |     7.13     7.13  | 7180000001443   7180000001443   [END]



     [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [% IDY]  |  [LEN R]  [LEN Q]  |  [COV R]  [COV Q] | [TAGS]
 ===============================================================================================================================
  4790727  4911492  |   120764        1  |   120766   120764  |    99.98  |  6397126   175592  |     1.89    68.78  | gi|28867243|ref|NC_004578.1|    7180000001443
  4898971  4955870  |   175592   118697  |    56900    56896  |    99.98  |  6397126   175592  |     0.89    32.40  | gi|28867243|ref|NC_004578.1|    7180000001443

6. AMOSCmp (Chromosome+3 plasmids ref) 

 Sanger reads
 Reference=complete genome(chromosome+3 plasmids) use "circular contig" in Celera 3.11 assembly
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids
 38 contigs: 15 for main chromosome, 1 for longer plasmid, 21 for shorter plasmid, 1 for "circular contig"
 The missoriented read pile corresponding to the chromosome (4. AMOSCmp of Sanger reads) has dissapeared
 AA ready for submission: /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids/AA/umd-20071030-141700.tar.gz


Solexa assemblied for different read coverages

Location 

 /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/sample/
 
 Several AMOScmp assemblies, using 10%,20%, ... 100%, of the P. syringae Solexa reads. 
 These would correspond to 3X,6X ... 30X, coverage 
 The read sampling was done randomly. One sample set for each coverage.

 all contigs
 desc    #elem   min     max     mean          stdev           sum
 10    43136   32      7712    135.11          140.61          5828148
 20    11243   32      20190   570.01          686.5           6408705
 30    2972    32      27962   2185.32         2804.56         6494784
 40    1058    32      63125   6152.98         7871.7          6509855
 50    455     32      163430  14319.01        19663.15        6515153
 60    267     32      328882  24406.61        46172.62        6516567
 70    166     32      671064  39260.9         84200.42        6517311
 80    143     32      906652  45577.16        111875.19       6517535
 90    117     32      1433643 55708.4         164246.61       6517883
 100   106     32      2067205 61489.83        230284.47       6517923
 
 chromo contigs
 desc    #elem   min     max     mean          stdev           sum
 10    42845   32      1845    133.32          118.36          5712348
 20    11124   32      9650    565.41          625.32          6289649
 30    2876    32      26076   2216.64         2714.92         6375063
 40    965     32      63125   6621.71         7893.19         6389957
 50    362     32      163430  17665.19        20565.31        6394800
 60    167     32      328882  38299.32        53660.75        6395987
 70    75      257     671064  85287.52        108858.19       6396564
 80    49      940     906652  130546.42       160470.1        6396775
 90    25      42603   1433643 255877.72       277650.54       6396943
 100   18      42603   2067205 355387.77       465907.88       6396980
 
 all gaps
 desc    #elem   min     max     mean    stdev   sum
 10    43137   1       3874    16.46   38.01   710112
 20    11242   1       3919    11.52   64.43   129555
 30    2971    1       3418    14.63   114.29  43476
 40    1056    1       3873    26.89   196.7   28405
 50    454     1       3415    50.89   291.04  23107
 60    265     1       3870    81.86   380.9   21693
 70    165     1       3868    126.96  486.88  20949
 80    141     1       3414    146.98  461.06  20725
 90    115     1       3418    177.19  520.11  20377
 100   104     1       3278    195.54  511.06  20337
 
 chromo gaps
 desc    #elem   min     max     mean    stdev   sum
 10    42846   1       240     15.98   16.33   684778
 20    11125   1       146     9.66    9.72    107477
 30    2876    1       76      7.67    7.73    22063
 40    965     1       58      7.42    7.8     7169
 50    362     1       48      6.42    7.08    2326
 60    167     1       58      6.82    7.63    1139
 70    76      1       55      7.39    7.9     562
 80    49      1       55      7.16    10.08   351
 90    25      1       45      7.31    10.12   183
 100   18      1       55      8.11    13.62   146

CBCB (new)

Alignment based trimming

!!! Reduced the duplications significantly

Solution:

1. align all reads (Solexa) to the reference using nucmer. I initially used minmatch=20, mincluster=20 (-c 20 -l 20) 

 6340136 reads
 5641782 (88.98%) aligned by nucmer -c 20 -l 20
 3453618 (54.47%) aligned by nucmer -c 32 -l 20
 2707005 (42.69%) aligned by nucmer -c 32 -l 32
Retrieved from "https://wiki.umiacs.umd.edu/cbcb/index.php?title=Pseudodomonas_syringae&oldid=2337"