Bumblebee

Data

• ~ 500B genome

• 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)

 Lane   Insert            ReadLen    #Reads 
 1      3K(2..6,avg 4K)   124        34,944,099 
 2      8K(7..9,avg 8K)   124        32,540,640

 3      500(450..600)     124        34,745,750  # gDNA
 5      500                          34,601,239
 6      500                          34,553,857
 7      500                          34,682,612
 8      500                          12,975,839

• Tasks to figure out:

1. Erroneous reads/bases, which we need to correct or discard
2. GC bias, so we can compute a-stats properly
3. Redundancy in the long paired ends, which are lane 1 and lane 2.
 

• Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
  • Some reads will begin in the circularization adaptor and thus will have only one usable read
  • Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
  • Most reads will have at least 36bp from each end before hitting the adaptor.
  • Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)

• circularization adaptors

 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG - revcomp -> CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 AGCATATTGAAGCATATTACATACGATATGCTTCAATAATGC

• Formatting: keep only the first 100bp (last 24 bp are anyway low qual)

• Location:

 /fs/szattic-asmg4/Bees/Bombus_impatiens

Assembly

• Meryl

 meryl -Dh -s 0-mercounts/asm-C-ms22-cm1 >! 22mers.hist
 Found 3136399464 mers.
 Found 379123530 distinct mers.
 Found 201257394 unique mers.
 Largest mercount is 12006651; 90 mers are too big for histogram.

• countKmers

 most frequent 22mer :                 AGCATACATTATACGAAGTTAT     ~ 16% of the seqs
 most frequent 42mer : CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA ~ 10%  of the seqs (pPAC7.9124-9165)  
 

• Location

 /fs/szdevel/dpuiu/SourceForge/wgs-assembler.030210/Linux-amd64/bin/runCA