Megachile rotundata: Difference between revisions
Jump to navigation
Jump to search
No edit summary |
|||
Line 45: | Line 45: | ||
326236387 numRandom | 326236387 numRandom | ||
326236387 numPacked | 326236387 numPacked | ||
LibraryName numActiveFRG numDelFRG numMatedFRG readLength clearLength | LibraryName numActiveFRG numDelFRG numMatedFRG readLength clearLength | ||
GLOBAL 326236387 0 315518526 37451489553 37418130441 | GLOBAL 326236387 0 315518526 37451489553 37418130441 |
Revision as of 01:12, 2 September 2010
Data
Original Traces
- 8 pairs of data files (paired ends)
cat trace.count | grep _1_ | sed 's/_sequence.txt//' | perl -ane 'print " ",$F[1],"\t",$F[0]/4,"\t",$F[0]/2,"\n";'
lib insert mates reads readLen ~coverage(500M genome) reverse adaptors comments s_2_1_3kbp 3000 21563283 43,126,566 124 11 ? circularizarion s_2_1_5kbp 5000/300 36218589 72,437,178 35 5 yes ? insert size is << 5kbp s_2_1_8kbp 8000 198377 396,754 124 0.1 ? ? s_3_1 475 35548153 71,096,306 124 18 s_4_1 475 35471044 70,942,088 124 18 s_5_1 475 35616846 71,233,692 124 18 s_6_1 475 35303840 70,607,680 124 18 s_7_1 475 34893313 69,786,626 124 18
Adaptors
>circularizarion CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA >circularizarion.revcomp TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
Location
/fs/szattic-asmg5/Bees/Megachile_rotundata/error_correction/large_libs/s_?_?_?kb.sequence.cor.all.txt ftp://ftp.cbcb.umd.edu/pub/data/assembly/Megachile_rotundata/reads/s_?_?_?kb.sequence.cor.all.txt.gz
Assemblies
- CA Version: 6.1
/fs/szdevel/dpuiu/SourceForge/wgs-6.1/Linux-amd64/bin/runCA
CA noOBT
- Gatekeeper : ~ 74X cvg
LOAD STATS 7 libInput 7 libLoaded 0 libErrors 5 libWarnings 326,236,387 frgLoaded 326236387 numRandom 326236387 numPacked LibraryName numActiveFRG numDelFRG numMatedFRG readLength clearLength GLOBAL 326236387 0 315518526 37451489553 37418130441 LegacyUnmatedReads 0 0 0 0 0 s_2_3kb 9107424 0 9107424 942165284 910444046 s_2_8kb 209336 0 209336 21814418 20787384 s_3 63618839 0 61696784 7343024554 7342819494 s_4 63544688 0 61255960 7291557748 7291478152 s_5 63370860 0 61084368 7271218123 7271051639 s_6 63780887 0 61685156 7359094156 7359012512 s_7 62604353 0 60479498 7222615270 7222537214
- Location
mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT