Kalanchoe: Difference between revisions
Jump to navigation
Jump to search
(→454) |
|||
Line 39: | Line 39: | ||
= Assembly = | = Assembly = | ||
* CA.454 | |||
. elem min q1 q2 q3 max mean n50 sum | |||
scf 29225 235 1161 1449 3293 233867 5972 22778 174536065 | |||
ctg 65154 64 1160 1502 2240 19244 1931 2133 125781315 | |||
deg 279542 62 302 452 579 6662 461 534 129007100 | |||
* SOAPdenovo.Illumina | |||
. elem min q1 q2 q3 max mean n50 sum | |||
scf 320855 100 141 275 590 56087 716 1987 229678477 | |||
ctg 3630647 32 34 50 79 21193 97 143 352876334 | |||
scf2 320855 100 141 269 579 56087 709 1993 227485865 | |||
ctg2 333643 33 138 260 560 45815 680 1873 226926306 | |||
shreds2 690592 1 139 270 610 2000 524 1107 362212087 | |||
* CA.454.IlluminaShreds | |||
. elem min q1 q2 q3 max mean n50 sum | |||
scf 26334 187 1200 1610 3603 583607 8703 43384 229194795 | |||
ctg 55625 64 1262 1975 3990 70870 3575 5949 198884011 | |||
deg 251480 64 267 437 560 17662 442 527 111232984 | |||
* Locations | |||
/fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454/ | /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454/ | ||
/fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/SOAPdenovo.Illumina/ | /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/SOAPdenovo.Illumina/ | ||
/fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454.IlluminaShreds/ | /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454.IlluminaShreds/ | ||
* Location: | * Ftp Location: | ||
ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/ | ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/ | ||
ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/README | ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/README |
Revision as of 14:41, 15 June 2011
Data
- 300M genome
- ~5x 454 from a variety of library sizes
- ~20x illumina (Illumina scale qualities).
- Location:
/fs/szattic-asmg7/Kalenchoe_genome/
454
- Read stats
LIB reads mates meaIns stdIns 20mers ids fff01.frg.gz 545792 0 AT GLMTKIY01 fff02.frg.gz 459461 0 AT GLMTKIY02 fff03.frg.gz 477691 0 AC GLZRKVN01 fff04.frg.gz 610848 0 AAACCCTAAACCCTAAACCCTA GKFZ9MZ01 fff05.frg.gz 450912 0 AAAACCCATAAAGTTGTTATTT GKFZ9MZ02 fff06.frg.gz 548462 0 AACAAGGCACACAGGGGATAGG GKH094001
fff11.frg.gz 418299 118317 20k,17072 4268 CG GMF8K3302 fff12.frg.gz 807808 273276 8k,6609 1652 AT GK7ZAL002 fff13.frg.gz 638072 205830 8k,6571 1642 ACGTACGTACGTACGTACGTAC GLC77YN02 fff14.frg.gz 771593 231598 3k,2749 687 AT GK7ZAL001 fff15.frg.gz 634113 165697 3k,2768 692 AT GLC77YN01
- linker issues
'titanium' == TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG and CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
- Locations
/fs/szattic-asmg7/Kalenchoe_genome/rawreads/FFF/ /fs/szattic-asmg7/Kalenchoe_genome/rawreads/FFFp/
Illumina
- Location
/fs/szattic-asmg7/Kalenchoe_genome/rawreads/Illumina/ /fs/szattic-asmg7/Kalenchoe_genome/rawreads/correctlyMatedIllumina/
Assembly
- CA.454
. elem min q1 q2 q3 max mean n50 sum scf 29225 235 1161 1449 3293 233867 5972 22778 174536065 ctg 65154 64 1160 1502 2240 19244 1931 2133 125781315 deg 279542 62 302 452 579 6662 461 534 129007100
- SOAPdenovo.Illumina
. elem min q1 q2 q3 max mean n50 sum scf 320855 100 141 275 590 56087 716 1987 229678477 ctg 3630647 32 34 50 79 21193 97 143 352876334
scf2 320855 100 141 269 579 56087 709 1993 227485865 ctg2 333643 33 138 260 560 45815 680 1873 226926306 shreds2 690592 1 139 270 610 2000 524 1107 362212087
- CA.454.IlluminaShreds
. elem min q1 q2 q3 max mean n50 sum scf 26334 187 1200 1610 3603 583607 8703 43384 229194795 ctg 55625 64 1262 1975 3990 70870 3575 5949 198884011 deg 251480 64 267 437 560 17662 442 527 111232984
- Locations
/fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454/ /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/SOAPdenovo.Illumina/ /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454.IlluminaShreds/
- Ftp Location:
ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/ ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/README