Pseudodomonas syringae: Difference between revisions

From Cbcb
Jump to navigation Jump to search
No edit summary
 
(88 intermediate revisions by the same user not shown)
Line 1: Line 1:
'''Pseudomonas syringae strain DC 3000'''
'''Pseudomonas syringae pv. tomato str. DC3000'''
 
 
== Data ==


Originally sequenced and finished at TIGR: published Sept 2003
Originally sequenced and finished at TIGR: published Sept 2003


NCBI:
=== NCBI ===
   AA: no assembly
   AA: no assembly
   TA: ftp://ftp.ncbi.nih.gov/pub/TraceDB/pseudomonas_syringae_pv_tomato_str_dc3000/ : 80,959 reads
   [ftp://ftp.ncbi.nih.gov/pub/TraceDB/pseudomonas_syringae_pv_tomato_str_dc3000/ TA] 80,959 reads  
   Genome Project: http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genomeprj&cmd=ShowDetailView&TermToSearch=15584  
   [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genomeprj&cmd=ShowDetailView&TermToSearch=15584 Genome Project]
  [http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=223283 Taxonomy] TaxId=223283
 
Chromosome + 2 plasmids:
  Name          Length    %GC    Info
  NC_004578.1    6,397,126 58.40  chromosome
  NC_004633.1    73,661    55.15  plasmid pDC3000A
  NC_004632.1    67,473    56.17  plasmid pDC3000B
  total          6,538,260
 
  Little similarity between the chromosome and plasmids.
  The 2 plasmids share a significant amount of DNA; see /fs/szasmg2/Bacteria/Pseudomonas_syringae/Data/nucmer/NC_004633-NC_004632.png


UNC:
=== UNC: Jeff Dangl ===


New sequence:
New sequence:
Read stats
  Type              File                            #reads            min    median  max    sum            mean    stdev  n50
  Solexa            DC3000.reads.filtered.fasta    6,340,136        32      32      32      202884352      32      0      32
  454p(end+linker)  DC3000.format.454Reads.fna      123,992          38      86      329    15623908        126.01  58.89  142
454                DC3000.TCA.454reads.format.fna  77,466            35      244    371    18627363        240.46  26.85  245
   * Solexa 3 lanes;  
   * Solexa 3 lanes;  
   * 454 shotgun 1/4 Plate (250bp read);  
   * 454 shotgun 1/4 Plate (250bp read);  
Line 16: Line 38:
       * contain a 44 bp linker in the middle
       * contain a 44 bp linker in the middle
       * the linker sequence is: GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
       * the linker sequence is: GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
       * there are some (not many) 454 paired end sequences that contain multiple instances of the linker (tandem): Example EUEIEUN01ANUGL_length=128_xy=0154_1891  
       * <span style="color:red">there are some (not many) 454 paired end sequences that contain multiple instances of the linker (tandem): Example EUEIEUN01ANUGL_length=128_xy=0154_1891 </span>
 
  <span style="color:red">
  Quality values are missing for all data sets!!!
  I assigned default qual=3 to all the base (.frg & .afg files)  </span>
 
454p
* Out of 123992 454 paired ends, 111028 (90%) align to linker (nucmer -c 20 -l 20)
* Non linked(end) sequences (5' & 3')
          #elem  min    max    mean    median  n50    sum
  five    111028  0      265    37      21      61      4090475
  three  111028  0      266    39      20      81      4385391
 
* 20bp is the mode
* 75% of the end sequences are 19-21 bp long
* 67871 out of 111028 end pairs align within 5kbp
            #elem  min    max    mean    stdev  sum
  distance  67871  1      4991    2450    702    166283200


UNC sequence data:
UNC sequence data: (not avail any more?)
   http://biology622.dhcp.unc.edu/~labweb/DCData/
   http://biology622.dhcp.unc.edu/~labweb/DCData/


UNC assembly:
UNC (e-mail):  
   * Theoretical minimum number of contigs we can obtain is 268 (our reads fail to cover 269 nucleotides).  
   * Theoretical minimum number of contigs we can obtain is 268 (our reads fail to cover 269 nucleotides).  
   * Our de novo assembly spans the genome in 853 contigs totaling 6,313,026 bp.  
   * Our de novo assembly spans the genome in 853 contigs totaling 6,313,026 bp.  
Line 29: Line 68:
   * average contig size 7401 bp.  
   * average contig size 7401 bp.  
   * The N50 = 37,444 bp.  
   * The N50 = 37,444 bp.  
   * Our largest BAMBUS "scaffold" is 2,565,761 bp,
   * Our largest BAMBUS "scaffold" is 2,565,761 bp
 
Data stats
  .                              #elem          min    median  max    sum            mean    stdev  n50
  DC3000.format.454Reads.fna      123992          38      86      329    15623908        126.01  58.89  142    DC3000 Paired End Reads
  DC3000.TCA.454reads.format.fna  77466          35      244    371    18627363        240.46  26.85  245    DC3000 454 Reads
  DC3000.reads.filtered.fasta    6340136        32      32      32      202884352      32      0      32      DC3000 Solexa Reads
  DC3000Plasmids.fa              2              67473  73661  73661  141134          70567  3094    73661  Pseudomonas syringae pv. tomato DC3000 Plasmids
  Psudomonas_syringae.fa          1              6397126 6397126 6397126 6397126        6397126 0      6397126 Pseudomonas syringae pv. tomato DC3000 reference


Files location:
Files location:
Line 43: Line 74:
   /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly
   /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly


Best CBCB assembly:
== Assemblies ==
 
=== 454 AMOScmp ===
  /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/454/2007_1015_AMOSCmp-relaxed
  no trimming;
  AMOScmp -D MINCLUSTER=20 -D MAXTRIM=10 -D MAJORITY=50 ...
 
  Stats:
  desc            #elem  min    max    mean    stdev  sum
  contigs        6131    43      8261    966.57  829.44  5926089
  pos_gaps        5622    1      10394  110.32  283.78  620259
  Slight improvement by doing alignment based trimming of the 454 reads
 
=== Solexa AMOScmp ===
 
  /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/2008_0116_AMOSCmp-relaxed
  Duplication if ALIGNWIGGLE=15
 
  Align all reads (Solexa) to the reference using nucmer.
 
  6340136 reads
  5641782 (88.98%) aligned by nucmer -c 20 -l 20
  3453618 (54.47%) aligned by nucmer -c 32 -l 20
  2707005 (42.69%) aligned by nucmer -c 32 -l 32
 
  AMOScmp -D MAJORITY=50 -D MINOVL=5 -D MINCLUSTER=20 -D ALIGNWIGGLE=2 ...
 
  Stats:
  desc            #elem  min    max    mean            stdev          sum
  contigs        187    20      577910  34862.83        91691.51        6519350
  pos_gaps        147    1      1716    131.05          288.69          19265
 
=== Solexa maq ===
 
  /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/2008_0213_maq/maq
 
  Stats:
  desc            #elem  min    max    mean            stdev          sum
  contigs        106    32      2067205 61489.83        230284.47      6517923
  pos_gaps        104    1      3278    195.54          511.06          20337
 
=== 454 + Solexa AMOScmp ===
 
  Locations:
    /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa-454/2008_1016_AMOSCmp-relaxed/
    ftp://ftp.cbcb.umd.edu/pub/data/dpuiu/Pseudomonas_syringae/Solexa-454/
 
  AMOScmp -D MINCLUSTER=20 -D MAXTRIM=20 -D MINOVL=5 -D MAJORITY=50 -D ALIGNWIGGLE=2 ...
 
  All stats:
  desc            #elem  min    max    mean            stdev          sum
  contigs        139    20      1895644 46899.82        243273.92      6519075
  pos_gaps        124    1      1809    156.78          323.66          19441
 
  Chromosome stats:
  desc            #elem  min    max    mean            stdev          sum
  contigs        8      85757  1895607 799498.75      692179.25      6395990
  pos_gape        2      4      9      6.5            3.53            13
 
=== 454 + Solexa + 454p AMOScmp ===
 
  Only the 454 paired ends that contain 1 single complete adaptor sequence were used (allmost all)
  149 contigs; very similar to the prev ome
 
=== Sanger AMOScmp ===
 
  /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_AMOSCmp-relaxed
  <span style="color:red">Many miss-oriented mates in the 4.8M-5M region of the chromosome</span>
  22 contigs
  [[Media:Pseudodomonas_syringae.Sanger.AMOSCmp.chromosome.png|Chromosome]]
  [[Media:Pseudodomonas_syringae.Sanger.AMOSCmp.chromosome_problem.png|Chromosome problem]]
 
=== Sanger Celera 3.11 ===
 
  /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_WGA
  22 scaff, 46 contigs, 181 degens
  <span style="color:red">Scaffold 7180000001443 looks circular: possible 163,074 bp plasmid
  aligns to 4.8M-5M "problem" region in the chromosome</span>
  [[Media:Pseudodomonas_syringae.Sanger.CA.circ_contig.7180000001443.png|7180000001443.png]]
 
      [S1]    [E1]  |    [S2]    [E2]  |  [LEN 1]  [LEN 2]  |  [% IDY]  |  [LEN R]  [LEN Q]  |  [COV R]  [COV Q]  | [TAGS]
  ===============================================================================================================================
        1  175592  |        1  175592  |  175592  175592  |  100.00  |  175592  175592  |  100.00  100.00  | 7180000001443  7180000001443  [IDENTITY]
        1    12519  |  163075  175592  |    12519    12518  |    99.98  |  175592  175592  |    7.13    7.13  | 7180000001443  7180000001443  [BEGIN]
    163075  175592  |        1    12519  |    12518    12519  |    99.98  |  175592  175592  |    7.13    7.13  | 7180000001443  7180000001443  [END]
 
 
      [S1]    [E1]  |    [S2]    [E2]  |  [LEN 1]  [LEN 2]  |  [% IDY]  |  [LEN R]  [LEN Q]  |  [COV R]  [COV Q] | [TAGS]
  ===============================================================================================================================
  4790727  4911492  |  120764        1  |  120766  120764  |    99.98  |  6397126  175592  |    1.89    68.78  | gi|28867243|ref|NC_004578.1|    7180000001443
  4898971  4955870  |  175592  118697  |    56900    56896  |    99.98  |  6397126  175592  |    0.89    32.40  | gi|28867243|ref|NC_004578.1|    7180000001443
 
=== Sanger AMOScmp  (Chromosome+3 plasmids ref) ===
 
  Reference=complete genome(chromosome+3 plasmids) use "circular contig" in Celera 3.11 assembly
  /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids
  38 contigs: 15 for main chromosome, 1 for longer plasmid, 21 for shorter plasmid, 1 for "circular contig"
  The missoriented read pile corresponding to the chromosome (4. AMOSCmp of Sanger reads) has dissapeared
  AA ready for submission: /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids/AA/umd-20071030-141700.tar.gz
 
=== Solexa assembled at different read coverages ===
 
  Location: /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/sample/
 
  Several assemblies, using 10%,20%, ... 100%, of the P. syringae Solexa reads.
  These would correspond to 3X,6X ... 30X coverage
  The read sampling was done randomly. One sample set for each coverage.
 
----
 
  Assembler: Sanger maq
  all contigs
  cvg  %reads  #ctgs  min    max    mean            stdev          sum
  3    10      43136  32      7712    135.11          140.61          5828148
  6    20      11243  32      20190  570.01          686.5          6408705
  9    30      2972    32      27962  2185.32        2804.56        6494784
  12    40      1058    32      63125  6152.98        7871.7          6509855
  15    50      455    32      163430  14319.01        19663.15        6515153
  18    60      267    32      328882  24406.61        46172.62        6516567
  21    70      166    32      671064  39260.9        84200.42        6517311
  24    80      143    32      906652  45577.16        111875.19      6517535
  27    90      117    32      1433643 55708.4        164246.61      6517883
  30    100    106    32      2067205 61489.83        230284.47      6517923
 
  chromo contigs
  cvg  %reads  #ctgs  min    max    mean            stdev          sum
  3    10      42845  32      1845    133.32          118.36          5712348
  6    20      11124  32      9650    565.41          625.32          6289649
  9    30      2876    32      26076  2216.64        2714.92        6375063
  12    40      965    32      63125  6621.71        7893.19        6389957
  15    50      362    32      163430  17665.19        20565.31        6394800
  18    60      167    32      328882  38299.32        53660.75        6395987
  21    70      75      257    671064  85287.52        108858.19      6396564
  24    80      49      940    906652  130546.42      160470.1        6396775
  27    90      25      42603  1433643 255877.72      277650.54      6396943
  30    100    18      42603  2067205 355387.77      465907.88      6396980
 
  all gaps
  cvg  %reads  #gaps  min    max    mean    stdev  sum
  3    10      43137  1      3874    16.46  38.01  710112
  6    20      11242  1      3919    11.52  64.43  129555
  9    30      2971    1      3418    14.63  114.29  43476
  12    40      1056    1      3873    26.89  196.7  28405
  15    50      454    1      3415    50.89  291.04  23107
  18    60      265    1      3870    81.86  380.9  21693
  21    70      165    1      3868    126.96  486.88  20949
  24    80      141    1      3414    146.98  461.06  20725
  27    90      115    1      3418    177.19  520.11  20377
  30    100    104    1      3278    195.54  511.06  20337
 
  chromo gaps
  cvg  %reads  #gaps  min    max    mean    stdev  sum
  3    10      42846  1      240    15.98  16.33  684778
  6    20      11125  1      146    9.66    9.72    107477
  9    30      2876    1      76      7.67    7.73    22063
  12    40      965    1      58      7.42    7.8    7169
  15    50      362    1      48      6.42    7.08    2326
  18    60      167    1      58      6.82    7.63    1139
  21    70      76      1      55      7.39    7.9    562
  24    80      49      1      55      7.16    10.08  351
  27    90      25      1      45      7.31    10.12  183
  30    100    18      1      55      8.11    13.62  146
 
----
 
  Assembler: AMOScmp
 
  all contigs
  cvg  %reads  #ctgs  min    max    mean            stdev          sum
  3    10      61330  20      9181    97.08          101.04          5954113
  6    20      18764  20      19803  343.93          431.9          6453593
  9    30      5723    20      28103  1137.41        1498.76        6509417
  12    40      2045    20      33780  3186.49        4337.72        6516385
  15    50      859    20      90346  7588.66        11436.97        6518661
  18    60      479    20      219894  13609.97        22470.18        6519176
  21    70      319    20      289494  20436.94        37964.34        6519384
  24    80      246    20      385663  26502.45        61309.04        6519605
  27    90      237    20      577910  27510.48        71767.85        6519985
  30    100    187    20      577910  34862.83        91691.51        6519350


1.
  chromo contigs
   /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454/2007_1009_AMOSCmp-relaxed
  cvg  %reads  #ctgs  min    max    mean            stdev          sum
   142 contigs (37 negative gaps)
  3    10      60923  20      1052    95.8            79.21          5836796
   based on the mix of 454 single reads + Solexa reads (no 454 paired ends)
   6    20      18583  20      4800    340.81          368.44          6333397
   No read trimming was done.  
   9    30      5567    22      20245  1147.53        1401.05        6388303
   AMOScmp used the following parameters:
   12    40      1883    20      33780  3396.09        4327.93        6394855
     nucmer -c 20
   15    50      699    24      90346  9151.31        12023.55        6396771
    casm-layout -t 20 -o 5
   18    60      313    29      219894  20437.56        25135.49        6396957
   "-t 20" allows for 20 bp long dirty sequence ends which seem to solve the "low quality" problem.
  21    70      155     32      289494 41271.96        45893.6        6397154
   22 large contigs
  24    80      82      28      385663  78014.63        85498.69        6397200
   27    90      64      35      577910 99957.57        109269.83      6397285
   30    100    40      46      577910  159930.32      139830.19      6397213


2.
  all gaps
   /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Solexa-454/2007_1015_AMOSCmp-relaxed-MAJORITY50
   cvg   %reads #gaps   min    max    mean    stdev  sum
   131 contigs (18 negative gaps)
  3    10      45068  1      2228    14.89  26.44  671499
   based on the mix of 454 single reads + Solexa reads (no 454 paired ends)
   6    20      11034  1      3148    10.81  49.56  119340
   No read trimming was done.  
   9    30      2816    1      2296    16.57  106.54  46663
   AMOScmp used the following parameters:
   12    40      1022    1      1903    25.98  125.51  26559
     nucmer -c 20
  15    50      456     1      1716    46.91  159.75 21394
     casm-layout -t 20 -o 5 -m 50
  18    60      294     1      1445    68.35  189.57  20097
   No read trimming was done.  
   21    70      221    1      1716    88.33  225.56  19523
   "-t 20" allows for 20 bp long dirty sequence ends which seem to solve the "low quality" problem.
   24    80      182    1      1716    105.12 244.55  19132
   "-m 20" merges some contigs together
   27    90      181    1      1716    103.78  235.41  18785
   10 large contigs
   30    100    147    1      1716    131.05  288.69  19265


   contig#       len     gc%
   chromo gaps
  4              2290968 59.00
  cvg  %reads  #gaps  min    max     mean    stdev   sum
   7              1817904 58.18
   3     10      44767   1      197    14.45   14.86   647093
   3             1405326 58.08
   6     20      10884   1      1008    9.02   17.01  98181
   5              648413  58.48
   9    30      2677    1      2296    9.88    70.77   26464
   2              192413  57.86
  12    40      869    1      685    7.8    24.09  6786
   6             87152   58.02
   15    50      303    1       59      6.55    6.88    1986
   131            71251   56.47
   18    60      137    1      33      7.35    7.22    1007
   1             32939   54.86
   21    70      65      1      33      6.83    6.9    444
   130            29120  59.36
   24    80      27      1      36      8.37    9.74    226
   9             20309   53.56
   27    90      18      1      42      8.83    11.44  159
   95            3589   59.46
   30   100    10      1      33      10.7    12.58  107

Latest revision as of 17:16, 28 May 2008

Pseudomonas syringae pv. tomato str. DC3000


Data

Originally sequenced and finished at TIGR: published Sept 2003

NCBI

 AA: no assembly
 TA 80,959 reads 
 Genome Project
 Taxonomy TaxId=223283

Chromosome + 2 plasmids:

 Name           Length    %GC    Info
 NC_004578.1    6,397,126 58.40  chromosome
 NC_004633.1    73,661    55.15  plasmid pDC3000A
 NC_004632.1    67,473    56.17  plasmid pDC3000B
 total          6,538,260
 Little similarity between the chromosome and plasmids.
 The 2 plasmids share a significant amount of DNA; see /fs/szasmg2/Bacteria/Pseudomonas_syringae/Data/nucmer/NC_004633-NC_004632.png

UNC: Jeff Dangl

New sequence:

Read stats

 Type               File                            #reads            min     median  max     sum             mean    stdev   n50
 Solexa             DC3000.reads.filtered.fasta     6,340,136         32      32      32      202884352       32      0       32
 454p(end+linker)   DC3000.format.454Reads.fna      123,992           38      86      329     15623908        126.01  58.89   142
454                DC3000.TCA.454reads.format.fna   77,466            35      244     371     18627363        240.46  26.85   245 
 * Solexa 3 lanes; 
 * 454 shotgun 1/4 Plate (250bp read); 
 * 454 paired ends 1/4 Plate : 
     * contain a 44 bp linker in the middle
     * the linker sequence is: GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
     * there are some (not many) 454 paired end sequences that contain multiple instances of the linker (tandem): Example EUEIEUN01ANUGL_length=128_xy=0154_1891 
 
 
 Quality values are missing for all data sets!!!
 I assigned default qual=3 to all the base (.frg & .afg files)  

454p

  • Out of 123992 454 paired ends, 111028 (90%) align to linker (nucmer -c 20 -l 20)
  • Non linked(end) sequences (5' & 3')
         #elem   min     max     mean    median  n50     sum
 five    111028  0       265     37      21      61      4090475
 three   111028  0       266     39      20      81      4385391
  • 20bp is the mode
  • 75% of the end sequences are 19-21 bp long
  • 67871 out of 111028 end pairs align within 5kbp
            #elem   min     max     mean    stdev   sum
 distance   67871   1       4991    2450    702     166283200

UNC sequence data: (not avail any more?)

 http://biology622.dhcp.unc.edu/~labweb/DCData/

UNC (e-mail):

 * Theoretical minimum number of contigs we can obtain is 268 (our reads fail to cover 269 nucleotides). 
 * Our de novo assembly spans the genome in 853 contigs totaling 6,313,026 bp. 
 * 98.7% of the genome is covered by a contig; 
 * 84% of the genome is covered by contigs 10,000 bp or greater. 
 * The average gap size between contigs is 98 bp; 
 * average contig size 7401 bp. 
 * The N50 = 37,444 bp. 
 * Our largest BAMBUS "scaffold" is 2,565,761 bp

Files location:

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Data
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly

Assemblies

454 AMOScmp

 /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/454/2007_1015_AMOSCmp-relaxed
 no trimming; 
 AMOScmp -D MINCLUSTER=20 -D MAXTRIM=10 -D MAJORITY=50 ...
 Stats:
 desc            #elem   min     max     mean    stdev   sum
 contigs         6131    43      8261    966.57  829.44  5926089
 pos_gaps        5622    1       10394   110.32  283.78  620259

 Slight improvement by doing alignment based trimming of the 454 reads

Solexa AMOScmp

 /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/2008_0116_AMOSCmp-relaxed
 Duplication if ALIGNWIGGLE=15
 Align all reads (Solexa) to the reference using nucmer. 
 6340136 reads
 5641782 (88.98%) aligned by nucmer -c 20 -l 20
 3453618 (54.47%) aligned by nucmer -c 32 -l 20
 2707005 (42.69%) aligned by nucmer -c 32 -l 32
 AMOScmp -D MAJORITY=50 -D MINOVL=5 -D MINCLUSTER=20 -D ALIGNWIGGLE=2 ...
 Stats:
 desc            #elem   min     max     mean            stdev           sum
 contigs         187     20      577910  34862.83        91691.51        6519350
 pos_gaps        147     1       1716    131.05          288.69          19265

Solexa maq

 /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/2008_0213_maq/maq
 Stats:
 desc            #elem   min     max     mean            stdev           sum
 contigs         106     32      2067205 61489.83        230284.47       6517923
 pos_gaps        104     1       3278    195.54          511.06          20337

454 + Solexa AMOScmp

 Locations: 
   /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa-454/2008_1016_AMOSCmp-relaxed/ 
   ftp://ftp.cbcb.umd.edu/pub/data/dpuiu/Pseudomonas_syringae/Solexa-454/ 
 AMOScmp -D MINCLUSTER=20 -D MAXTRIM=20 -D MINOVL=5 -D MAJORITY=50 -D ALIGNWIGGLE=2 ...
 All stats:
 desc            #elem   min     max     mean            stdev           sum
 contigs         139     20      1895644 46899.82        243273.92       6519075
 pos_gaps        124     1       1809    156.78          323.66          19441
 Chromosome stats:
 desc            #elem   min     max     mean            stdev           sum
 contigs         8       85757   1895607 799498.75       692179.25       6395990
 pos_gape        2       4       9       6.5             3.53            13

454 + Solexa + 454p AMOScmp

 Only the 454 paired ends that contain 1 single complete adaptor sequence were used (allmost all)
 149 contigs; very similar to the prev ome

Sanger AMOScmp

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_AMOSCmp-relaxed
 Many miss-oriented mates in the 4.8M-5M region of the chromosome
 22 contigs
 Chromosome
 Chromosome problem

Sanger Celera 3.11

 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_WGA
 22 scaff, 46 contigs, 181 degens
 Scaffold 7180000001443 looks circular: possible 163,074 bp plasmid
 aligns to 4.8M-5M "problem" region in the chromosome
 7180000001443.png
     [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [% IDY]  |  [LEN R]  [LEN Q]  |  [COV R]  [COV Q]  | [TAGS]
 ===============================================================================================================================
        1   175592  |        1   175592  |   175592   175592  |   100.00  |   175592   175592  |   100.00   100.00  | 7180000001443   7180000001443   [IDENTITY]
        1    12519  |   163075   175592  |    12519    12518  |    99.98  |   175592   175592  |     7.13     7.13  | 7180000001443   7180000001443   [BEGIN]
   163075   175592  |        1    12519  |    12518    12519  |    99.98  |   175592   175592  |     7.13     7.13  | 7180000001443   7180000001443   [END]


     [S1]     [E1]  |     [S2]     [E2]  |  [LEN 1]  [LEN 2]  |  [% IDY]  |  [LEN R]  [LEN Q]  |  [COV R]  [COV Q] | [TAGS]
 ===============================================================================================================================
  4790727  4911492  |   120764        1  |   120766   120764  |    99.98  |  6397126   175592  |     1.89    68.78  | gi|28867243|ref|NC_004578.1|    7180000001443
  4898971  4955870  |   175592   118697  |    56900    56896  |    99.98  |  6397126   175592  |     0.89    32.40  | gi|28867243|ref|NC_004578.1|    7180000001443

Sanger AMOScmp (Chromosome+3 plasmids ref)

 Reference=complete genome(chromosome+3 plasmids) use "circular contig" in Celera 3.11 assembly
 /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids
 38 contigs: 15 for main chromosome, 1 for longer plasmid, 21 for shorter plasmid, 1 for "circular contig"
 The missoriented read pile corresponding to the chromosome (4. AMOSCmp of Sanger reads) has dissapeared
 AA ready for submission: /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids/AA/umd-20071030-141700.tar.gz

Solexa assembled at different read coverages

 Location: /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/sample/
 
 Several assemblies, using 10%,20%, ... 100%, of the P. syringae Solexa reads. 
 These would correspond to 3X,6X ... 30X coverage 
 The read sampling was done randomly. One sample set for each coverage.

 Assembler: Sanger maq

 all contigs
 cvg   %reads  #ctgs   min     max     mean            stdev           sum
 3     10      43136   32      7712    135.11          140.61          5828148
 6     20      11243   32      20190   570.01          686.5           6408705
 9     30      2972    32      27962   2185.32         2804.56         6494784
 12    40      1058    32      63125   6152.98         7871.7          6509855
 15    50      455     32      163430  14319.01        19663.15        6515153
 18    60      267     32      328882  24406.61        46172.62        6516567
 21    70      166     32      671064  39260.9         84200.42        6517311
 24    80      143     32      906652  45577.16        111875.19       6517535
 27    90      117     32      1433643 55708.4         164246.61       6517883
 30    100     106     32      2067205 61489.83        230284.47       6517923
 chromo contigs
 cvg   %reads  #ctgs   min     max     mean            stdev           sum
 3     10      42845   32      1845    133.32          118.36          5712348
 6     20      11124   32      9650    565.41          625.32          6289649
 9     30      2876    32      26076   2216.64         2714.92         6375063
 12    40      965     32      63125   6621.71         7893.19         6389957
 15    50      362     32      163430  17665.19        20565.31        6394800
 18    60      167     32      328882  38299.32        53660.75        6395987
 21    70      75      257     671064  85287.52        108858.19       6396564
 24    80      49      940     906652  130546.42       160470.1        6396775
 27    90      25      42603   1433643 255877.72       277650.54       6396943
 30    100     18      42603   2067205 355387.77       465907.88       6396980
 all gaps
 cvg   %reads  #gaps   min     max     mean    stdev   sum
 3     10      43137   1       3874    16.46   38.01   710112
 6     20      11242   1       3919    11.52   64.43   129555
 9     30      2971    1       3418    14.63   114.29  43476
 12    40      1056    1       3873    26.89   196.7   28405
 15    50      454     1       3415    50.89   291.04  23107
 18    60      265     1       3870    81.86   380.9   21693
 21    70      165     1       3868    126.96  486.88  20949
 24    80      141     1       3414    146.98  461.06  20725
 27    90      115     1       3418    177.19  520.11  20377
 30    100     104     1       3278    195.54  511.06  20337
 chromo gaps
 cvg   %reads  #gaps   min     max     mean    stdev   sum
 3     10      42846   1       240     15.98   16.33   684778
 6     20      11125   1       146     9.66    9.72    107477
 9     30      2876    1       76      7.67    7.73    22063
 12    40      965     1       58      7.42    7.8     7169
 15    50      362     1       48      6.42    7.08    2326
 18    60      167     1       58      6.82    7.63    1139
 21    70      76      1       55      7.39    7.9     562
 24    80      49      1       55      7.16    10.08   351
 27    90      25      1       45      7.31    10.12   183
 30    100     18      1       55      8.11    13.62   146

 Assembler: AMOScmp
 
 all contigs
 cvg   %reads  #ctgs   min     max     mean            stdev           sum
 3     10      61330   20      9181    97.08           101.04          5954113
 6     20      18764   20      19803   343.93          431.9           6453593
 9     30      5723    20      28103   1137.41         1498.76         6509417
 12    40      2045    20      33780   3186.49         4337.72         6516385
 15    50      859     20      90346   7588.66         11436.97        6518661
 18    60      479     20      219894  13609.97        22470.18        6519176
 21    70      319     20      289494  20436.94        37964.34        6519384
 24    80      246     20      385663  26502.45        61309.04        6519605
 27    90      237     20      577910  27510.48        71767.85        6519985
 30    100     187     20      577910  34862.83        91691.51        6519350
 chromo contigs
 cvg   %reads  #ctgs   min     max     mean            stdev           sum
 3     10      60923   20      1052    95.8            79.21           5836796
 6     20      18583   20      4800    340.81          368.44          6333397
 9     30      5567    22      20245   1147.53         1401.05         6388303
 12    40      1883    20      33780   3396.09         4327.93         6394855
 15    50      699     24      90346   9151.31         12023.55        6396771
 18    60      313     29      219894  20437.56        25135.49        6396957
 21    70      155     32      289494  41271.96        45893.6         6397154
 24    80      82      28      385663  78014.63        85498.69        6397200
 27    90      64      35      577910  99957.57        109269.83       6397285
 30    100     40      46      577910  159930.32       139830.19       6397213
 all gaps
 cvg   %reads  #gaps   min     max     mean    stdev   sum
 3     10      45068   1       2228    14.89   26.44   671499
 6     20      11034   1       3148    10.81   49.56   119340
 9     30      2816    1       2296    16.57   106.54  46663
 12    40      1022    1       1903    25.98   125.51  26559
 15    50      456     1       1716    46.91   159.75  21394
 18    60      294     1       1445    68.35   189.57  20097
 21    70      221     1       1716    88.33   225.56  19523
 24    80      182     1       1716    105.12  244.55  19132
 27    90      181     1       1716    103.78  235.41  18785
 30    100     147     1       1716    131.05  288.69  19265
 chromo gaps
 cvg   %reads  #gaps   min     max     mean    stdev   sum
 3     10      44767   1       197     14.45   14.86   647093
 6     20      10884   1       1008    9.02    17.01   98181
 9     30      2677    1       2296    9.88    70.77   26464
 12    40      869     1       685     7.8     24.09   6786
 15    50      303     1       59      6.55    6.88    1986
 18    60      137     1       33      7.35    7.22    1007
 21    70      65      1       33      6.83    6.9     444
 24    80      27      1       36      8.37    9.74    226
 27    90      18      1       42      8.83    11.44   159
 30    100     10      1       33      10.7    12.58   107