Bumblebee: Difference between revisions
Jump to navigation
Jump to search
| Line 143: | Line 143: | ||
s_7_2_sequence.cor.txt 32518568 30 84 110 124 124 101.60 124 3303807321 | s_7_2_sequence.cor.txt 32518568 30 84 110 124 124 101.60 124 3303807321 | ||
s_8_1_sequence.cor.txt 11777821 30 113 124 124 124 112.30 124 1322658923 | s_8_1_sequence.cor.txt 11777821 30 113 124 124 124 112.30 124 1322658923 | ||
s_8_2_sequence.cor.txt 12176364 30 84 110 124 124 101.51 124 1236034348 | s_8_2_sequence.cor.txt 12176364 30 84 110 124 124 101.51 124 1236034348 | ||
total 301,738,113 . . . . . . . 31958664367 | total 301,738,113 . . . . . . . 31958664367 | ||
total (64bp+) 275,763,594 . . . . . . . 30693543885 | total (64bp+) 275,763,594 . . . . . . . 30693543885 | ||
s_1,2 13,396,743 | |||
* Mates | * Mates | ||
| Line 155: | Line 157: | ||
s_7.mates 31891468 | s_7.mates 31891468 | ||
s_8.mates 11168258 | s_8.mates 11168258 | ||
total 144,840,545 | total 144,840,545 | ||
s_1,2 6,354,249 | |||
* Files | * Files | ||
Revision as of 15:13, 22 April 2010
Data
- ~ 500B genome
- Complete mitochondrion genomes:
NC_011923.1 15468 14.67 Bombus hypocrita sapporoensis mitochondrion, complete genome NC_010967.1 16434 13.22 Bombus ignitus mitochondrion, complete genome only 88% identity; no rearrangements, only snps, short indels
Traces
- 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
Lane Insert ReadLen #Mates #Reads Coverage Orientation Comments 1 3K(2..6,avg 4K) 124 34,944,099 14X outie 865,687(1.2%) reads have qual==0 2 8K(7..9,avg 8K) 124 32,540,640 13X outie 3 400 124 34,745,750 . gDNA ; originally thought to be 500bp insert instead of 400 5 400 124 34,601,239 . 6 400 124 34,553,857 . 7 400 124 34,682,612 . 8 400 124 12,975,839 . 3-8 151,559,297 303,118,594 75X 1-8 219,044,036 438,088,072 108X
Two new 3kb libraries to come; ~ 70% are true pair ends
- Adaptors
>circularizarion CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA >circularizarion.revcomp TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG >5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG >3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
- Location
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[1235678]_[12]_sequence.txt : s_1-8 libs /fs/szattic-asmg4/Bees/Bombus_impatiens/3kb_Bimpatiens.txt : 88 reads
Tasks to figure out
- Erroneous reads/bases, which we need to correct or discard
- GC bias, so we can compute a-stats properly
- Redundancy in the long paired ends, which are lane 1 and lane 2.
- Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
- Some reads will begin in the circularization adaptor and thus will have only one usable read
- Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
- Most reads will have at least 36bp from each end before hitting the adaptor.
- Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)
- A small but significant number of reads from the 3kb and 8kb libraries are not recircularized.
- Thus their mate distance is +400bp rather than -3kb or -8kb.
- It's apparently the result of a faulty batch of cre recombinase. This causes problems with contiging and scaffolding.
- It is possible to remove these reads by removing
- mate pairs where neither read is trimmed (thus no adapter ligation may have occurred)
- mate pairs where one read begins with the adapter sequence.
- We are working on this, up to now our paired assembly stages have been disappointing.
- Matt's idea is to exclude all mate pair reads that don't have evidence of the linker with flanking useful sequence, as a way to avoid uncircularized molecules that will give misleading "mate pairs" only 400 bp apart.
- There has been no trimming of the adaptor, which is the 42 base 454 adaptor, so its presence can be used to indicate potentially good mate pairs.
- Even tossing half the mate pairs might not be a problem, as we have perhaps too many anyway.
- But you will also need to toss redundant mate pairs, and that will indeed reduce the total a lot.
- Just to be clear - the 500 base mate pairs should have no such problems, except that as Matt has found from his preliminary assembly, the mean fragment length is actually 400 bp rather than 500 bp (and the 3 and 8 kb PE reads are typically shorter than nominally given, e.g. more like 2.5 and 6 kb).
- You'll also need to throw out all the reads where one of the mates /starts/ with linker, I assume you'd do that anyway. We're also working on ways round this; one might be when we get a better assembly we'll find some better characteristic to filter the unrecircularized reads on.
Trimming
- Quality trimming: trim all bases with fastq quality eq "B" (0)
cat *fastq | ~/bin/fastq2clq.pl
- Adaptor trimming: Align all subsets to adaptors
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA 3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
id len gc% C 42 30.95 3 52 55.77 5 67 59.70
nucmer -l 8 -c 16 -b 32 -g 32 adaptors.seq ... delta-filter -l 16 -q ... cat *.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 ...
- Adaptor/primers median positions in the reads
Lib adaptorPos 5'primerPos 3'primerPos s_1 34-75 0-36 0-19 s_2 2-40 0-36 0-19
- Mate stats
Lib #mates adaptor.bothMates adaptor.noMate adaptor.oneMate adaptor.oneMate(filtered) s_1 34944099 269156 9804247 24870696 6048164(17.3%) s_2 32540640 91528 16181288 16267824 1061858( 3.2%) total 67484739 7110022(10.5%)
- Filtered read clr stats
Lib #mates #reads min q1 q2 q3 max mean n50 sum s_1 6048164 12096328 64 80 95 115 124 96.56 101 1,168,064,632 s_2 1061858 2123716 64 80 96 115 124 96.59 101 205,122,226 total 7110022 14220044 64 80 95 115 124 96.57 101 1,373,186,858
- Filtered read GC% stats
Lib #reads min q1 q2 q3 max mean n50 s_1 12096322 0.00 31.93 36.26 42.35 100.00 37.45 38 s_2 2123715 0.00 31.88 36.46 42.48 100.00 37.56 38
- Other frequent kmers
26mer : ACGTTATAACGTATTACGTTATATGG -> revcomp -> CCATATAACGTAATACGTTATAACGT : ~10% of the traces 10mer : AAAAAAAAAA TTTTTTTTTT : ~32% of the traces 53mer: CGATTTCCATGGCGTCGTTTGAGGATTCCAATACGGCGAACCTGTTGTGAGTG : ~2% of the mito seqs (either begin or end); not present in the 2 complete mito's (probably ok)
- Data processing pipeline
s_[12] : /nfshomes/dpuiu/bin/fastq2adaptorFreeFrg.amos s_[35678] : /nfshomes/dpuiu/bin/fastqfrg.amos
- Location:
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[1235678]_[12]_sequence.txt # original fastq files /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/s_[1235678]_[12]_sequence.cor.txt # corrected fastq files
/fs/szattic-asmg5/Bees/Bombus_impatiens/s_[12]/all/s_[12].64.rev.frg # adaptor free s_[12] mated reads /fs/szattic-asmg5/Bees/Bombus_impatiens/error_free/frg/s_[1235678].frg # adaptor free & corrected s_[1235678] reads
D Kelly's trimming
- Reads
. elem min q1 q2 q3 max mean n50 sum s_1_1_sequence.cor.txt 5436814 30 71 90 115 124 89.70 100 487673256 s_1_2_sequence.cor.txt 5864225 30 77 92 110 124 93.27 98 546956864 s_2_1_sequence.cor.txt 1053858 30 80 96 118 124 97.16 102 102395785 s_2_2_sequence.cor.txt 1041846 30 78 93 110 124 93.51 99 97426679 s_3_1_sequence.cor.txt 33668302 30 105 124 124 124 111.04 124 3738530761 s_3_2_sequence.cor.txt 32554322 30 82 108 124 124 100.42 120 3269039697 s_5_1_sequence.cor.txt 33579744 30 109 124 124 124 111.65 124 3749192427 s_5_2_sequence.cor.txt 32465412 30 84 112 124 124 102.13 124 3315553171 s_6_1_sequence.cor.txt 33535725 30 109 124 124 124 111.60 124 3742602285 s_6_2_sequence.cor.txt 32390877 30 83 109 124 124 100.92 123 3268875471 s_7_1_sequence.cor.txt 33674235 30 112 124 124 124 112.19 124 3777917379 s_7_2_sequence.cor.txt 32518568 30 84 110 124 124 101.60 124 3303807321 s_8_1_sequence.cor.txt 11777821 30 113 124 124 124 112.30 124 1322658923 s_8_2_sequence.cor.txt 12176364 30 84 110 124 124 101.51 124 1236034348 total 301,738,113 . . . . . . . 31958664367 total (64bp+) 275,763,594 . . . . . . . 30693543885 s_1,2 13,396,743
- Mates
s_1.mates 5320163 s_2.mates 1034086 s_3.mates 31857304 s_5.mates 31820553 s_6.mates 31748713 s_7.mates 31891468 s_8.mates 11168258 total 144,840,545 s_1,2 6,354,249
- Files
/fs/szattic-asmg5/Bees/Bombus_impatiens/error_free/frg/s_[12].rev.frg /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/frg/s_[35678].frg
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/s_?_[12]_sequence.cor.txt # fastq ; s_[12] m
Assembly
CA.bog s_1
- Input : 31*2M s_1 reads trimmed to 100bp & formatted by fastqToCA
- Spec file
unitigger = bog ovlOverlapper = mer obtMerThreshold = 400 ovlMerThreshold = 120 doOverlapTrimming = 0
- Unitigger : max utg len=852bp
- Consensus after unitigger : 3 out of 129 jobs failed
- Location
/scratch1/Bombus_impatiens/Assembly/31M
CA.utg s_1,2 filtered
- Input: 7*2M s_1 & s_2 reads formatted by convert-fasta-to-v2.pl
- Filter:
- only one read from the mate contains the adaptor in the 64..124bp range
- both reads from the mate have good quality in the 0..64bp range
- Spec file
unitigger = utg ovlOverlapper = ovl obtMerThreshold = 400 ovlMerThreshold = 200 doOverlapTrimming = 0 => reads < 64 bp atre trimmed by the gatekeeper; no need to trim
- ovlStore stats
#ovls/read reads min q1 q2 q3 max mean n50 sum 14220044 0 1 5 31 514 31.30 131 445090932
- final stats
. elem min q1 q2 q3 max mean n50 sum ctg 2 1004 1004 1055 1055 1055 1029.50 1055 2059 deg 1433143 64 115 129 164 1028 145.79 145 208938949 assembled 7557472 singletons 6662572
- Mate redundancy
cat 9-terminator/asm.posmap.frgdeg | sort -nk2 -nk3 | perl ~/bin/posmap2ovl.pl | p 'chop $F[1]; chop $F[2]; print "$F[1] $F[2]\n"; print "$F[2] $F[1]\n";' | count.pl -m 2 | more
- Location
/scratch1/Bombus_impatiens/Assembly/14M.redo
SOAPdenovo s_3..8 orig (CBCB)
- Kmer=23
- Input: s_3,5,6,7,8 original reads
- Error correction: no
- Summary
. elem min q1 q2 q3 max mean n50 sum scf 571,114 100 106 115 141 156066 162.19 137 92,628,126 ctg 54049561 24 24 28 42 2049 35.04 35 1,893,660,606 gapSeq 49518 28 123 143 181 424 152.97 158 7,574,733
- Longest scaff:
scaffold672 156066 35.63
cat asm.scafSeq | ~/bin/scafffasta2scaff.pl | tail -21 | getSummary.pl -i 2 -t ctg cat asm.scafSeq | ~/bin/scafffasta2scaff.pl | tail -21 | head -20| getSummary.pl -i 3 -t gap . elem min q1 q2 q3 max mean n50 sum ctg 21 481 2943 5480 9853 19523 7268.48 12202 152638 gap 20 1 166 183 246 302 171.40 233 3428
SOAPdenovo s_3..8 corr (CBCB)
- Kmer=31
- Input: s_3,5,6,7,8 reads
- Error correction: yes
- Summary
elem min q1 q2 q3 max mean n50 sum scf 106,217 100 140 434 2418 102317 2,177 7099 23,1261,742
SOAPdenovo s_3..8 corr (Illinois)
- Kmer=31
- Input: s_3,5,6,7,8 reads
- Error correction: yes; UIUC method
- Summary
. elem min q1 q2 q3 max mean n50 sum scf 17,550 13,460 236,225,169 ctg 4004102 31 97,618 1916 6020 230,333,709 ctg100bp+ 120167 100
SOAPdenovo s_1..8 corr (Illinois)
- Kmer=31
- Input: s_1,2,3,5,6,7,8 reads
- Error correction: yes; CBCB method
- Summary
. elem min q1 q2 q3 max mean n50 sum ctg200bp+ 43603 201 752 2786 9518 167534 7637.63 19895 333,023,446
- Locations
ftp://stan.cropsci.uiuc.edu/download/bombus1-k64-contigs.fa.min200 ginkgo:/scratch1/Bombus_impatiens/Assembly/SOAPdenovo.s_1-8.cor.UIUC/
CA s_1..8 corr OBT (CBCB) *
Issues
- Used outie s_1,2 lib ; needs to be redone
runCA spec
doOverlapTrimming = 1 ovlOverlapper = ovl unitigger = bog # cmd buildUnitigs *BatchSize = 2000000 *BlockSize = 2000000 ovlMemory = 8GB
Gatekeeper
gatekeeper -dumpfragments asm.gkpStore | grep ^fragmentClear ... LOAD STATS 7 libInput 7 libLoaded 0 libErrors 301738113 frgInput 301738113 frgLoaded 25974519 frgErrors 144840545 lkgInput 124575590 lkgLoaded 20264955 lkgErrors 0 lkgWarnings 275763594 numRandom 301738113 numNormal GLOBAL STATS 301738113 FRG 7 LIB LibraryName numActiveFRG numDeletedFRG numMatedFRG readLength clearLength GLOBAL 274282535 27455578 247151634 30524746650 29445986650 LegacyUnmatedReads 0 0 0 0 0 s_1 10409320 891719 9039810 996306280 994802849 s_2 2054575 41129 1987728 197829588 197593453 s_3 59894531 6328093 53925476 2382786529 2127257586 s_5 60127274 5917882 54512448 2459696212 2209078913 s_6 59813485 6113117 54062058 2396359740 2152656620 s_7 60278536 5914267 54647258 2476326572 2237423989 s_8 21704814 2249371 18976856 2435572545 2347304056
gatekeeper -dumplibraries -tabular asm.gkpStore UID IID Orientation Mean StdDev NumFeatures s_1 1 I 4000 400 1582823088 s_2 2 I 8000 800 1582823088 s_3 3 I 400 40 1582823088 s_5 4 I 400 40 1582823088 s_6 5 I 400 40 1582823088 s_7 6 I 400 40 1582823088 s_8 7 I 400 40 1582823088
s_1,2 lib : ids:1..13,396,744 overlap jobs that need to be redone : 1036 out of 11476 < 10% ~/bin/getOvlJobsCount.pl 2000000 2000000 301738113 | p '/(\d+)-(\d+)\s+(\d+)-(\d+)/; print $_ if($1<14000000 or $3<14000000);'
Meryl
meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 Found 23686053415 mers. Found 265670791 distinct mers. Found 8682767 unique mers. ... #freq count % 1 8682767 0.0327 0.0004 2 4288602 0.0488 0.0007 72* 3803015 0.7150 0.3229 73 3797615 0.7293 0.3346
OBT/Overlap
- job count
n=((301738113/2000000)+0.5)=151 OBT/OVL jobs = n*n/2 =151*76=11476 ~ 20 min/OBT job =~ 0.33 hr/OBT job => 0.33*11476/32=5 days
- OBT trimming
key sum count mean CLR 31958664367 301738113 105.915239043733 OBTINITIAL 30779687358 301610679 102.051052900551 OBTMERGE 30052401719 301610679 99.6397137483318 OBTCHIMERA 30052138325 301610679 99.638840456972 LATEST 30052138325 301610679 99.638840456972
- use OBTCHIMERA as CLR if want to redo the assembly !!!
- Overlap counts
cat asm.repeatmodel.lib.00*stats | egrep '^Lib|nSamples|median' | p 'chomp; if(/Lib/) {print "\n$_"} else { print " $F[1]"}' | pretty -o
Lib 0 5' 199542773 50
Lib 0 3' 199542773 50
Lib 1 5' 6682072 38
Lib 1 3' 6682072 37
Lib 2 5' 1306720 37 ???
Lib 2 3' 1306720 42 ???
Lib 3 5' 43868663 50
Lib 3 3' 43868663 50
Lib 4 5' 43939366 51
Lib 4 3' 43939366 50
Lib 5 5' 43620676 50
Lib 5 3' 43620676 50
Lib 6 5' 43903838 51
Lib 6 3' 43903838 50
Lib 7 5' 16221438 50
Lib 7 3' 16221438 50
- Frgcorr jobs: 151
wc -l 3-overlapcorrection/cat-corrects.frgcorrlist
- Ovlcorr jobs: 151
wc -l 3-overlapcorrection/cat-corrects.frgcorrlist
- Failures
- overlapStore: too many files (max 10240) ; fix: recompile the code
- chimera: FAILED file seems to be truncated but contains records from all libs; fix: link asm.chimera.report.FAILED asm.chimera.report
Bog
- Run time: 14 hr
- default unitigger : does not seem to work on such big datasets
- Utg len stats:
cat 4-unitigger/asm.cga.0 | perl ~/bin/cga2utgLen.pl | getSummary.pl -i 0 -j 1 elem min q1 q2 q3 max mean n50 sum 63916892 47 85 150 150 22861 125.23 150 8004296170
Bog consensus
- job count :
wc -l 4-unitigger/asm.partitioningInfo 110
- Failures
grep FAILED 5-consensus/asm*err 5-consensus/asm_090.err:MultiAlignUnitig()-- Unitig 62979707 FAILED. Could not align fragment 264046761. Fix: # update layout tigStore -g asm.gkpStore -t asm.tigStore 2 -u 62979707 -d layout > utg.62979707.layout ~/bin/updateUTGlayout.pl utg.62979707.layout > utg.62979707.layout.update tigStore -g asm.gkpStore -t asm.tigStore 2 -u 62979707 -R utg.62979707.layout.update # create success files touch 5-consensus/asm_090.success 5-consensus/consensus.success # relaunch runCA
Cgw
- Failures
grep -B 5 "^Failure message:" runCA.log
Cgw consensus
- job count : 84
wc -l 7-CGW/asm.partitionInfo
- ctg count: 1698486
cat 7-CGW/asm.partitionInfo | /nfshomes/dpuiu/bin/sum.pl -i 3 -t ctgs | pretty -o
Terminator
- Failure:
- buildPosMap : segFault :ids too long???
Stats
cat asm.iidtouid | awk '{print $1}' | uniq -c
257786946 FRG
2786974 UTG
1652316 CTG
15009 SCF
. elem min q1 q2 q3 max mean n50 sum scf 15009 74 4786 9789 20021 415318 16916.33 29133 253897199 ctg 145036 64 93 116 1035 138630 1498.67 7726 217361459 deg 1507280 54 98 118 146 1434 148.28 137 223502287 utg 2786974 54 90 110 142 25644 197.04 277 549140918 singletons 61129865 seqs 301738113
Location
ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor/ # assembly ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor/asm.gkpStore.OBTCHIMERACLR : dumped OBT clear ranges, 0/1 undel/del
CA s_1..8 corr OBT redo (CBCB) *
Issues
Fixed outie s_1,2 lib
runCA spec
doOverlapTrimming = 0 !!! already done in the prev assembly ovlOverlapper = ovl # same unitigger = bog # same BatchSize = 2000000 # must be the same so overlaps are not redone BlockSize = 2000000 # must be the same ...
Input
Modified frg files: dumped from the prev assembly gatekeeper; undelete act:D fragments so the ids stay the save; reverse s_1,2 reads
Gatekeeper
same
Overlap
Rerun only on some of the jobs
Frgcorr
Failed on 144 out of 151 jobs
Location
ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo/ # assembly
CA s_1..8 corr noOBT (CBCB) *
Issues
- Used outie s_1,2 lib ; needs to be redone
runCA spec
doOverlapTrimming = 0 ovlOverlapper = ovl unitigger = utg # cmd unitigger
Overlap
cat asm.repeatmodel.lib.00*stats | egrep '^Lib|nSamples|median' | p 'chomp; if(/Lib/) {print "\n$_"} else { print " $F[1]"}' | pretty -o
Lib 0 5' 212707959 51
Lib 0 3' 212707959 51
Lib 1 5' 7387977 39
Lib 1 3' 7387977 39
Lib 2 5' 1413291 40 ???
Lib 2 3' 1413291 45 ???
Lib 3 5' 46756517 51
Lib 3 3' 46756517 51
Lib 4 5' 46786172 52
Lib 4 3' 46786172 51
Lib 5 5' 46531611 52
Lib 5 3' 46531611 51
Lib 6 5' 46891503 52
Lib 6 3' 46891503 51
Lib 7 5' 16940888 52
Lib 7 3' 16940888 51
Bog
- Utg len stats:
elem min q1 q2 q3 max mean n50 sum 71125093 66 95 150 150 23390 130.41 150 9275136839
- Location:
walnut:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor.noOBT