Bumblebee: Difference between revisions
Jump to navigation
Jump to search
| Line 1,097: | Line 1,097: | ||
* Contaminant list: ??? | * Contaminant list: ??? | ||
/fs/szattic-asmg4/tmagoc/bees_bacteria/IDs | /fs/szattic-asmg4/tmagoc/bees_bacteria/IDs | ||
* NCBI email (Dec 23rd) | |||
there are 3 contigs that need to be trimmed: | |||
Contig name Length Span(s) Apparent source | |||
7180002728824 11695 72..148 Escherichia coli | |||
7180002730077 25748 22703..25611 Escherichia coli | |||
7180002740828 30102 134..1688 Escherichia coli | |||
Since these are internal hits, consider whether the contig needs to split (if the E.coli was the 'joining' element). | |||
Revision as of 21:42, 20 January 2011
Data
- ~ 500Mbp genome
- Complete mitochondrion genomes:
NC_011923.1 15468 14.67 Bombus hypocrita sapporoensis mitochondrion, complete genome NC_010967.1 16434 13.22 Bombus ignitus mitochondrion, complete genome only 88% identity; no rearrangements, only snps, short indels
- NCBI TaxId
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=132113
Traces
- 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
Lane Insert ReadLen #Mates #Reads Coverage Orientation Comments #RepeatsReads 1 4K 124 34,944,099 14X outie 865,687(1.2%) reads qual==0 30,576,297 (44%) 2 8K 124 32,540,640 13X outie 26,972,424 (41%) 3 400 124 34,745,750 . 8,319,335 (12%) 5 400 124 34,601,239 . 8,398,759 (12%) 6 400 124 34,553,857 . 7 400 124 34,682,612 . 8 400 124 12,975,839 . 9 3K 124 29,615,036 . outie new3kb ; received 05/18/2010 3-8 151,559,297 303,118,594 75X 1-8 219,044,036 438,088,072 108X 1-9 248,659,072 497,318,144
Two new 3kb libraries to come; ~ 70% are true pair ends
Adaptors
>circularizarion CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA >circularizarion.revcomp TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG >5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG >3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Frequent kmers
s_1 s_2 s_3
1 CGTAATAACTTCGTATAGCATA|CGTATAACTTCGTATAATGTAT 15.2 4.59 2.829 # not assembled
2 AATGTATGCTATACGAAGTTAT|ATAACTTCGTATAGCATACATT 5.56 19.02 0.525 # not assembled
3 CGTTATAACGTATTACGTTATA|TGTATGCTATACGAAGTTATTA 5.2 4.56 .
4 TACATTATACGAAGTTATACGA|TATATGGTATGACGTTATAACG 3.39 1.87 0.365
5 ATATAACGTAATACGTTATAAC|TATAACGTATTACGTTATATGG 2.86 2.71 1.595
6 ACGTTATAACGTCATCCCATAT|ATACCATATAACGTAATACGTT 2.11 2.62 .
7 TACGTTATAACGTCATACCATA|TCCATTTTACACTGCAAATGTA 1.98 2.04 1.749
8 CTTAAACGTCGAAATATCTCCA|TTACGTTATATGGGATGACGTT 0.87 1.16 1.136
9 GAGCGCTTAAACGTCGAAATAT|ATGAAATCTAGCCGTCATTTCC 0.73 1.02 1.442
10 ACGTAATACGTTATAACGTCAT|ATTTCCTTCCCGTTGGAGATAT 0.67 1.1 1.477
11 CTGCTGAACCGCTCTTCCGATC|GATCGGAAGAGCGGTTCAGCAG 0.61 3.92 0.045 # not assembled
12 ACGGTCACAGCTTGTCTGTAAG|TGTAAAATGGAGTTCAACGAGC 0.31 1.73 0.798
13 ACGGTGGTGCATTACATTTGCA|GGCGAATGGCGCCTGATGCGGT 0.28 0.87 0.949 # not assembled
14 CAGAAAAGCATCTTACGGATGG|TACATACCTCGCTCTGCTAATC 0.04 2.47 . # not assembled
- Location
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[1235678]_[12]_sequence.txt : s_1-8 libs /fs/szattic-asmg4/Bees/Bombus_impatiens/new3kb/s_1_?_sequence.txt : new3kb lib received 05/18/2010 /fs/szattic-asmg4/Bees/Bombus_impatiens/3kb_Bimpatiens.txt : 88 new3kbr test reads
Tasks to figure out
- Erroneous reads/bases, which we need to correct or discard
- GC bias, so we can compute a-stats properly
- Redundancy in the long paired ends, which are lane 1 and lane 2.
- Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
- Some reads will begin in the circularization adaptor and thus will have only one usable read
- Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
- Most reads will have at least 36bp from each end before hitting the adaptor.
- Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)
- A small but significant number of reads from the 3kb and 8kb libraries are not recircularized.
- Thus their mate distance is +400bp rather than -3kb or -8kb.
- It's apparently the result of a faulty batch of cre recombinase. This causes problems with contiging and scaffolding.
- It is possible to remove these reads by removing
- mate pairs where neither read is trimmed (thus no adapter ligation may have occurred)
- mate pairs where one read begins with the adapter sequence.
- We are working on this, up to now our paired assembly stages have been disappointing.
- Matt's idea is to exclude all mate pair reads that don't have evidence of the linker with flanking useful sequence, as a way to avoid uncircularized molecules that will give misleading "mate pairs" only 400 bp apart.
- There has been no trimming of the adaptor, which is the 42 base 454 adaptor, so its presence can be used to indicate potentially good mate pairs.
- Even tossing half the mate pairs might not be a problem, as we have perhaps too many anyway.
- But you will also need to toss redundant mate pairs, and that will indeed reduce the total a lot.
- Just to be clear - the 500 base mate pairs should have no such problems, except that as Matt has found from his preliminary assembly, the mean fragment length is actually 400 bp rather than 500 bp (and the 3 and 8 kb PE reads are typically shorter than nominally given, e.g. more like 2.5 and 6 kb).
- You'll also need to throw out all the reads where one of the mates /starts/ with linker, I assume you'd do that anyway. We're also working on ways round this; one might be when we get a better assembly we'll find some better characteristic to filter the unrecircularized reads on.
Trimming
- Quality trimming: trim all bases with fastq quality eq "B" (0)
cat *fastq | ~/bin/fastq2clq.pl
- Adaptor trimming: Align all subsets to adaptors
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA 3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
id len gc% C 42 30.95 3 52 55.77 5 67 59.70
nucmer -l 8 -c 16 -b 32 -g 32 adaptors.seq ... delta-filter -l 16 -q ... cat *.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 ...
- Adaptor/primers median positions in the reads
Lib adaptorPos 5'primerPos 3'primerPos s_1 34-75 0-36 0-19 s_2 2-40 0-36 0-19
- Mate stats
Lib #mates adaptor.bothMates adaptor.noMate adaptor.oneMate adaptor.oneMate(filtered) s_1 34944099 269156 9804247 24870696 6048164(17.3%) s_2 32540640 91528 16181288 16267824 1061858( 3.2%) total 67484739 7110022(10.5%)
- Filtered read clr stats
Lib #mates #reads min q1 q2 q3 max mean n50 sum s_1 6048164 12096328 64 80 95 115 124 96.56 101 1,168,064,632 s_2 1061858 2123716 64 80 96 115 124 96.59 101 205,122,226 total 7110022 14220044 64 80 95 115 124 96.57 101 1,373,186,858
- Filtered read GC% stats
Lib #reads min q1 q2 q3 max mean n50 s_1 12096322 0.00 31.93 36.26 42.35 100.00 37.45 38 s_2 2123715 0.00 31.88 36.46 42.48 100.00 37.56 38
- Other frequent kmers
26mer : ACGTTATAACGTATTACGTTATATGG -> revcomp -> CCATATAACGTAATACGTTATAACGT : ~10% of the traces 10mer : AAAAAAAAAA TTTTTTTTTT : ~32% of the traces 53mer: CGATTTCCATGGCGTCGTTTGAGGATTCCAATACGGCGAACCTGTTGTGAGTG : ~2% of the mito seqs (either begin or end); not present in the 2 complete mito's (probably ok)
- Data processing pipeline
s_[12] : /nfshomes/dpuiu/bin/fastq2adaptorFreeFastq.amos s_[35678] : /nfshomes/dpuiu/bin/fastqfrg.amos
- Location:
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[1235678]_[12]_sequence.txt # original fastq files /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/s_[1235678]_[12]_sequence.cor.txt # corrected fastq files
/fs/szattic-asmg5/Bees/Bombus_impatiens/s_[12]/all/s_[12].64.rev.frg # adaptor free s_[12] mated reads /fs/szattic-asmg5/Bees/Bombus_impatiens/error_free/frg/s_[1235678].frg # adaptor free & corrected s_[1235678] reads
D Kelly's trimming
- Method: http://github.com/davek44/error_correction
- Read lens stats
lib reads min q1 q2 q3 max mean n50 sum #repeatReads s_1_1_sequence.cor.txt 5,436,814 30 71 90 115 124 89.70 100 487673256 1,071,779 (20%) s_1_2_sequence.cor.txt 5,864,225 30 77 92 110 124 93.27 98 546956864 1,208,767 (20%) s_2_1_sequence.cor.txt 1,053,858 30 80 96 118 124 97.16 102 102395785 222,290 (21%) s_2_2_sequence.cor.txt 1,041,846 30 78 93 110 124 93.51 99 97426679 208,029 (20%) s_3_1_sequence.cor.txt 33,668,302 30 105 124 124 124 111.04 124 3738530761 (12%) s_3_2_sequence.cor.txt 32,554,322 30 82 108 124 124 100.42 120 3269039697 s_5_1_sequence.cor.txt 33,579,744 30 109 124 124 124 111.65 124 3749192427 s_5_2_sequence.cor.txt 32,465,412 30 84 112 124 124 102.13 124 3315553171 s_6_1_sequence.cor.txt 33,535,725 30 109 124 124 124 111.60 124 3742602285 s_6_2_sequence.cor.txt 32,390,877 30 83 109 124 124 100.92 123 3268875471 s_7_1_sequence.cor.txt 33,674,235 30 112 124 124 124 112.19 124 3777917379 s_7_2_sequence.cor.txt 32,518,568 30 84 110 124 124 101.60 124 3303807321 s_8_1_sequence.cor.txt 11,777,821 30 113 124 124 124 112.30 124 1322658923 s_8_2_sequence.cor.txt 12,176,364 30 84 110 124 124 101.51 124 1236034348 s_9_1_sequence.cor.txt 21,273,603 30 87 124 124 124 104.52 124 2223545139 #new3kb added 05/18/2010 s_9_2_sequence.cor.txt 20,769,027 30 86 124 124 124 103.68 124 2153436097 #new3kb added 05/18/2010
s_1,2 13,396,743 s_1..8 301,738,113 . . . . . . . 31958664367 s_2..8 (64bp+) 275,763,594 . . . . . . . 30693543885
- Read/Mate counts
lib reads mates range s_1 11301039 5320163 s_2 2095704 1034086 11301040..13396743 s_3 66222624 31857304 s_5 66045156 31820553 s_6 65926602 31748713 s_7 66192803 31891468 s_8 23954185 11168258 total 301738113 144,840,545 s_1,2 13,396,743 6,354,249
- Files
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[129]_[012]_sequence.cor.rev.txt # adaptor free corrected reads (long inserts) /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt # corrected reads (short inserts) /fs/szattic-asmg5/Bees/Bombus_impatiens/error_free/frg/s_[12].rev.frg /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/frg/s_[35678].frg
Assembly
- SOAP version 1.04: /nfshomes/dpuiu/szdevel/SOAPdenovo_Release1.04/
- CA version 6.0 /fs/szdevel/dpuiu/SourceForge/wgs-assembler.030210/
SOAPdenovo s_1..8 CBCB-corr (Illinois)
- From: Kim Walden 04/30/2010
- Input: s_1,2,3,5,6,7,8 reads
- Error correction: yes; CBCB method
- Kim's e-mail
I ran it in a stepwise fashion, not adding any of the available options and only changing K=31. I then ran their more recent GapCloser algorithm, not the version that is part of the package when using option -F in "scaff". I used their "all" assembly once, and I noticed that it automatically uses the -F option during scaffolding Also, I used your data from the ftp site without checking for redundancy in the 3kb and 8kb lanes; did Daniela do the same?
- Summary
elements min_len max_len mean n50 sum
contigs(>100) 103858 100 85850 2227 7541 231387390 # prior to scaffolding;
scaffolds&contigs(>100) 12663 100 4648588 19282 1040109 244171008 # post-scaffolding and gap-filling
scaffolds(span) 3736 252 4648588 64874 1047164 242369898 # same prior data minus contigs that didn't assemble into scaffolds.
scaffolds(len; no N's) 3736 172 4585806 64034 1027043 239233801 # computed by CBCB
- Locations
ginkgo:/scratch1/Bombus_impatiens/Assembly/SOAPdenovo.s_1-8.cor.UIUC.redo/Bimp_Salz_corr_050310_NewGapCloser.fasta # backup /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-8.cor.UIUC.redo/
# online http://www.life.illinois.edu/robertson/private/ Login: robertson password: dna
SOAPdenovo s_1..8 CBCB-corr (CBCB)
- Stats:
elem min max mean n50 sum contigs(all) 9943851 31 85850 60 45 594773555 contigs(>100) 106213 100 85850 2177 7084 231246190 scaffolds+contigs(>100) 12473 100 5933710 20428 1086614 254800874 # based on scafSeq file scaffolds(span) 3664 236 5933710 69090 1115496 253148288 # based on scafSeq file scaffolds(len) 3664 134 5522831 63411 1059378 232338949 readsAssembled 208389968 # based on readOnContig file readsFiltered 289681090 # based on readOnContig & log file readsTotal 301738113 # based on config file readsDeleted 441343 # based on log file
- Run gapClosing on assembly:
stillOpen 14784 closed 42379
- Contig cvg: GC bias:
cat asm.K31.contig100.infoseq | ~/bin/getCorrelationDescriptive.pl -i 2 -j 3 => -0.709501493345893
cat asm.K31.contig1K.infoseq | ~/bin/getCorrelationDescriptive.pl -i 2 -j 3 => -0.923151349747983
#100+ ctgs . elem min q1 q2 q3 max mean n50 sum len 106213 100 140 437 2420 85850 2177 7084 231246190 gc 106213 0.00 33.13 38.00 43.44 100.00 38.74 39 4115066 cvg 106213 0.6 39.0 50.8 58.9 160.8 47.38 54 5032329
#1K+ ctgs . elem min q1 q2 q3 max mean n50 sum len 41965 1000 1860 3295 6338 85850 5110 7726 214421699 gc 41965 19.18 34.31 37.96 41.79 59.25 38.19 38 1602711 cvg 41965 8.0 42.0 49.9 55.8 93.8 47.74 51 2003339
- Run soap2 to map reads back to the assembly: "-l 32 -v 2"
readsAligned 173063062
- Locations
mulberry:/scratch0/Bombus_impatiens/Assembly/SOAPdenovo.s_1-8.cor/ # original /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-8.cor/ # backup
SOAPdenovo s_1..9 CBCB-corr (CBCB) **
- Uses the new 3Kbp library : s_9 (reads have been reversed)
- Stats:
. elem min q1 q2 q3 max mean n50 sum scf 11178 100 111 135 390 5655980 23014 1205321 257251549 ctg 10856652 31 . . . 85850 57 43 627095607 ctg100+ 106741 100 . . . 85850** 2165 6939 231167576 scfSeqContigs 67900 100 340 1788 4373 85819 3437 7586 233372689 scfSeqContigsClosed 20651 100 128 488 7991 600179 11715 64083 241921308
- Location
mulberry:/scratch2/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/ # original /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/ # backup
CA s_1..8 corr OBT (CBCB)
Issues
- Used outie s_1,2 lib ; needs to be redone
runCA spec
doOverlapTrimming = 1 ovlOverlapper = ovl unitigger = bog # cmd buildUnitigs *BatchSize = 2000000 *BlockSize = 2000000 ovlMemory = 8GB doExtendClearRanges = 0 # fast run
Gatekeeper
- ~ 58X cvg
gatekeeper -dumpfragments asm.gkpStore | grep ^fragmentClear ... LOAD STATS 7 libInput 7 libLoaded 0 libErrors 301738113 frgInput 301738113 frgLoaded 25974519 frgErrors 144840545 lkgInput 124575590 lkgLoaded 20264955 lkgErrors 0 lkgWarnings 275763594 numRandom 301738113 numNormal GLOBAL STATS 301738113 FRG 7 LIB LibraryName numActiveFRG numDeletedFRG numMatedFRG readLength clearLength #egrep 'ATATAACGTAATACGTTATAAC|GTTATAACGTATTACGTTATAT' GLOBAL 274282535 27455578 247151634 30524746650 29445986650 LegacyUnmatedReads 0 0 0 0 0 s_1 10409320 891719 9039810 996306280 994802849 #1134233(11%) s_2 2054575 41129 1987728 197829588 197593453 #224648(11%) s_3 59894531 6328093 53925476 2382786529 2127257586 #3037085(5%) s_5 60127274 5917882 54512448 2459696212 2209078913 #5% s_6 59813485 6113117 54062058 2396359740 2152656620 #5% s_7 60278536 5914267 54647258 2476326572 2237423989 #5% s_8 21704814 2249371 18976856 2435572545 2347304056 #5%
gatekeeper -dumplibraries -tabular asm.gkpStore UID IID Orientation Mean StdDev NumFeatures s_1 1 I 4000 400 1582823088 s_2 2 I 8000 800 1582823088 s_3 3 I 400 40 1582823088 s_5 4 I 400 40 1582823088 s_6 5 I 400 40 1582823088 s_7 6 I 400 40 1582823088 s_8 7 I 400 40 1582823088
s_1,2 lib : ids:1..13,396,744 overlap jobs that need to be redone : 1036 out of 11476 < 10% ~/bin/getOvlJobsCount.pl 2000000 2000000 301738113 | p '/(\d+)-(\d+)\s+(\d+)-(\d+)/; print $_ if($1<14000000 or $3<14000000);'
Meryl
meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 Found 23686053415 mers. Found 265670791 distinct mers. Found 8682767 unique mers. Largest mercount is 21,987,616; 668 mers are too big for histogram. ... #freq count % 1 8682767 0.0327 0.0004 2 4288602 0.0488 0.0007 3 3041005 0.0603 0.0011 ... 72* 3803015 0.7150 0.3229 ... 1048158 1 1.0000 0.9274
fasta2tab.pl /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/0-mercounts/asm.nmers.ovl.fasta | sort -n -r | head -5 21987616 ATATAACGTAATACGTTATAAC 20992872 CGTTATAACGTATTACGTTATA 20510821 ACGTTATAACGTATTACGTTAT 20484950 CCATATAACGTAATACGTTATA 20452950 CATATAACGTAATACGTTATAA
cat egrep.sh egrep -c 'ATATAACGTAATACGTTATAAC|GTTATAACGTATTACGTTATAT' /fs/szattic-asmg5/Bees/Bombus_impatiens/error_free/seq_obt/*clean.seq > egrep.count /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2 ...
OBT
- job count
n=((301738113/2000000)+0.5)=151 OBT/OVL jobs = n*n/2 =151*76=11476 ~ 20 min/OBT job =~ 0.33 hr/OBT job => 0.33*11476/32=5 days
- OBT trimming
key sum count mean CLR 31958664367 301738113 105.915239043733 OBTINITIAL 30779687358 301610679 102.051052900551 OBTMERGE 30052401719 301610679 99.6397137483318 OBTCHIMERA 30052138325 301610679 99.638840456972 LATEST 30052138325 301610679 99.638840456972
- use OBTCHIMERA as CLR if want to redo the assembly !!!
Overlap
- job count : same as OBT
- Overlap counts
cat asm.repeatmodel.lib.00*stats | egrep '^Lib|nSamples|median' | p 'chomp; if(/Lib/) {print "\n$_"} else { print " $F[1]"}' | pretty -o
Lib 0 5' 199542773 50
Lib 0 3' 199542773 50
Lib 1 5' 6682072 38
Lib 1 3' 6682072 37
Lib 2 5' 1306720 37 ???
Lib 2 3' 1306720 42 ???
Lib 3 5' 43868663 50
Lib 3 3' 43868663 50
Lib 4 5' 43939366 51
Lib 4 3' 43939366 50
Lib 5 5' 43620676 50
Lib 5 3' 43620676 50
Lib 6 5' 43903838 51
Lib 6 3' 43903838 50
Lib 7 5' 16221438 50
Lib 7 3' 16221438 50
- 199542773 out of 257786946 (77%) usable reads had overlaps
- 7988792 out of 11443537 (69%) usable s_1,2 reads had overlaps
Frg/Ovl correction
- Frgcorr jobs: 151
wc -l 3-overlapcorrection/cat-corrects.frgcorrlist
- Ovlcorr jobs: 151
wc -l 3-overlapcorrection/cat-corrects.frgcorrlist
OverlapStore
- Failures
- overlapStore: too many files (max 10240) ; fix: recompile the code
- chimera: FAILED file seems to be truncated but contains records from all libs; fix: link asm.chimera.report.FAILED asm.chimera.report
Bog
- Run time: 14 hr
- default unitigger : does not seem to work on such big datasets
- Utg len stats:
cat 4-unitigger/asm.cga.0 | perl ~/bin/cga2utgLen.pl | getSummary.pl -i 0 -j 1 elem min q1 q2 q3 max mean n50 sum 63916892 47 85 150 150 22861 125.23 150 8004296170
Bog consensus
- job count :
wc -l 4-unitigger/asm.partitioningInfo 110
- Failures
grep FAILED 5-consensus/asm*err
5-consensus/asm_090.err:MultiAlignUnitig()-- Unitig 62979707 FAILED. Could not align fragment 264046761.
# Fix:
# update layout (CA 6.1)
mkdir utg
# update layout (CA 6.1)
grep FAILED 5-consensus/asm*err | awk '{print $3}' | sort -u -n | p 'print "tigStore -g asm.gkpStore -t asm.tigStore 2 -u $F[0] -d layout > utg/$F[0].layout\n";' | ~/bin/scheduler.pl
grep FAILED 5-consensus/asm*err | awk '{print $3}' | sort -u -n | p 'print "~/bin/updateUTGlayout.pl utg/$F[0].layout > utg/$F[0].layout.update\n ";' | ~/bin/scheduler.pl
grep FAILED 5-consensus/asm*err | awk '{print $3}' | sort -u -n | p 'print "tigStore -g asm.gkpStore -t asm.tigStore 2 -R utg/$F[0].layout.update\n" ;' | ~/bin/scheduler.pl -c 1
grep FAILED 5-consensus/asm*err | sed 's/\.err:/ /' | awk '{print $1}' | sort -u | p 'print "touch $F[0].success\n";' | ~/bin/scheduler.pl
# create success file
touch 5-consensus/consensus.success
# relaunch runCA
Cgw
- Failures
grep -B 5 "^Failure message:" runCA.log
Cgw consensus
- job count : 84
wc -l 7-CGW/asm.partitionInfo
- ctg count: 1698486
cat 7-CGW/asm.partitionInfo | /nfshomes/dpuiu/bin/sum.pl -i 3 -t ctgs | pretty -o
Terminator
- Failure:
- buildPosMap : segFault :ids too long???
Fix: split asm file(optional) and reassign new accession numbers cd split/ ~/bin/splitAsm.pl < asm.asm => ... CCO.asm, SCF.asm cat CCO.asm CLK.asm SCF.asm SLK.asm | ~/bin/newAsmIds.pl | buildPosMap -o asm
Stats
- Bb.qc
- Stats
. elem min q1 q2 q3 max mean n50 sum scf 15009 74 4786 9789 20021 415318 16916.33 29133 253897199 ctg 145036 64 93 116 1035 138630 1498.67 7726 217361459 deg 1507280 54 98 118 146 1434 148.28 137 223502287 utg 2786974 54 90 110 142 25644 197.04 277 549140918 singletons 61129865 usableSeqs 257786946
- Stats (100bp+)
elem min max mean n50 sum contigs(>100) 99429 100 138630 2148 7972 213595680 scaffolds(span) 14992 100 415318 16935 29133 253895676 scaffolds(len) 14991 100 303946 14499 24091 217357577
- Library stats (totals)
lib ctg sur deg singl total s_1 2251597 162800 3119665 3988095 9522157 s_2 424821 41107 563656 891795 1921379 s_3 28880189 1078891 13600909 12735637 56295626 s_5 28983834 1077334 13561390 12962731 56585289 s_6 28663974 1062939 13559494 12896855 56183262 s_7 28784505 1058364 13713200 13020274 56576343 s_8 10455533 383065 5229814 4634478 20702874 all 128444453 4864500 63348128 61129865 257786930
- Library stats (percentages)
lib ctg sur deg singl total s_1 24 2 33 42 100 s_2 22 2 29 46 100 s_3 51 2 24 23 100 s_5 51 2 24 23 100 s_6 51 2 24 23 100 s_7 51 2 24 23 100 s_8 51 2 25 22 100
Mate redundancy
- Criteria:
Given 2 mates 1: a1,a2 2: b1,b1 We have the following 2 overlaps 1: a1,b1 a2,b2 2: a1,b2 a2,b1 At least 75% of one read overlaps the other read
- Location:
cd /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor/9-terminator/
wc -l s_1.mates asm.posmap.frgutg.s_1.* 5320163 s_1.mates # input mates (from FRG file; 2 reads/mate) 1232734 asm.posmap.frgutg.s_1.mates # assembled mates (both reads assembled) 366262 asm.posmap.frgutg.s_1.redundant_mates # redundant assembled mates (there is another s_1 assembled mate pair with overlapping reads) => 29.7% redundancy 312206 asm.posmap.frgutg.s_1.redundant_mate_pairs # redundant assembled mate pairs wc -l s_2.mates asm.posmap.frgutg.s_2.* 1034086 s_2.mates # input mates (from FRG file; 2 reads/mate) 255905 asm.posmap.frgutg.s_2.mates # assembled mates (both reads assembled) 110570 asm.posmap.frgutg.s_2.redundant_mates # redundant assembled mates (there is another s_1 assembled mate pair with overlapping reads) => 43.2% redundancy 1871747 asm.posmap.frgutg.s_2.redundant_mate_pairs # redundant assembled mate pairs 11937 asm.posmap.frgutg.s_2.redundant_mate_clusters # redundant assembled mate clusters
Runtimes
# step hours 0 gatekeeper 5.36 1 initialTrim 2.07 2 meryl 9.90 9 overlap.sh 11.31 11 find 0.00 16 overlapStore 13.79 17 consolidate 5.12 18 merge-trimming 1.41 19 chimera(1) 10.04 20 overlap.sh 49.86 21 find 0.00 22 overlapStore 16.68 23 frgcorr.sh 5.57 24 cat-corrects 0.10 25 ovlcorr.sh 4.64 26 cat-erates 0.90 27 overlapStore 6.67 28 buildUnitigs 13.88 29 gatekeeper 1.31 30 consensus.sh 3.41 31 cgw(1) 65.00 43 gatekeeper 4.39 44 consensus.sh 4.70 46 terminator 6.26 47 asmOutputFasta 7.75 48 dumpSingletons 3.68 49 buildPosMap(1) 3.79
Location
ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor/ # original assembly ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor/asm.gkpStore.OBTCHIMERACLR # dumped OBT clear ranges, 0/1 undel/del /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor # backup
CA s_1..8 corr OBT redo (CBCB)
Issues
- Fixed outie s_1,2 lib : clear ranges will be different
- s_3..8 : stay the same
runCA spec
doOverlapTrimming = 0 !!! already done in the prev assembly saveOverlaps = 1 !!! it was actually set to 0 for this run; otherwise the ovb.gz files get deleted ovlOverlapper = ovl # same unitigger = bog # same BatchSize = 2000000 # must be the same so overlaps are not redone BlockSize = 2000000 # must be the same ... doExtendClearRanges = 1 # initially set to 2; seems to take too long => reset to 1
Input
- Modified frg files:
- dumped "CA s_1..8 corr OBT" assembly gatekeeper
- undelete act:D fragments so the ids stay the save
- reverse s_1,2 reads
Gatekeeper
- Make sure the iids match
Overlap
- Rerun only the overlap jobs for the s_1,2 reads
OverlapStore
- To build faster in the future
e 'foreach ("0000000001".."0000000058") { print "overlapStore -c $_.ovlStore -g asm.gkpStore/ -i 0 -M 8192 1-overlapper/$_/*gz\n" }' | scheduler.pl # 13min/job
e 'foreach ("0000000002".."0000000058") { print "overlapStore -m 0000000001.ovlStore $_.ovlStore\n" }' # 3 min/job
total=2*13+57*3=3.5 hrs (instead of 13.85 reported in runCA.log)
Frgcorr
- Initial failure: on 144 out of 151 jobs : the gatekeeper id's originally did not match (5 reads missing from s_5 lib shifted all the other reads)
Ovlcorr
- The error rate on overlaps with error went down by ~ 1.28%
Bog
cat 4-unitigger/asm.cga.0 | perl ~/bin/cga2utgLen.pl | getSummary.pl -i 0 -j 1 elem min q1 q2 q3 max mean n50 sum 60970504 47 85 150 150 93191 126.17 150 7692801690
- Unitig stats
tigStore -g asm.gkpStore -t asm.tigStore 43 -D properties | grep -c ^unitig_num_frags # 60,970,523 : total unitigs
tigStore -g asm.gkpStore -t asm.tigStore 43 -D properties | grep ^unitig_num_frags | grep -c ' 1$' # 59,776,572 : unitigs with only 1 read
tigStore -g asm.gkpStore -t asm.tigStore 43 -D properties | grep ^unitig_num_frags | grep -v ' 1$' | getSummary.pl -i 2 # stats for unitig with 2+ reads
elem min q1 q2 q3 max mean n50 sum
1read/utg 59,776,572 59,776,572
2+reads/utg 1,193,951 2 3 6 28 74715 165.84 4712 198,010,374
Bog consensus
- job count :
wc -l 4-unitigger/asm.partitioningInfo 110
- Failures: 1 failed unitig
grep FAILED 5-consensus/asm*err 5-consensus/asm_022.err:MultiAlignUnitig()-- Unitig 115198 FAILED. Fix: same as before
Cgw
- Failure:
- after 7-0-CGW/asm.ckp.4
tail runCA.log ERROR: Negative variance for chunk 59905266* in scaffold 6409 (AEnd=-163479.174700 BEnd=-163491.446700) 37980:Scaffold 6409: 37981- Idx Chunk ( Start, Variance) ( End, Variance) Len 37982- 0: 60983787 ( 0, 0) ( 31646, 823) 31646 37983- 1: 69691 ( 35389, 934) ( 31650, 837) 3739 37984- 2: 59907028 ( 35103, 942) ( 42035, 1122) 6932 37985- 3: 60799298 ( 41640, 1132) ( 64897, 1737) 23257 37986- 4: 60975976 ( 64924, 1784) ( 88439, 2395) 23515 37987- 5: 60988396 ( 88431, 2416) ( 122023, 3289) 33592 37988- 6: 60988698 ( 121551, 3324) ( 123589, 3377) 2038 37989- 7: 59905266* ( 122331, -163479) ( 121859, -163491) 472 37990- 8: 60988599 ( 122275, 170138) ( 134564, 170457) 12289
./AS_REZ/GapFillREZ.C:5666: int Estimate_Chunk_Ends(VarArrayStack_Entry_t*, int, int, LengthT*, LengthT*, ChunkInstanceT*, float*, Scaffold_Fill_t*, int*, int*, int*): Assertion `min_right_variance >= 0.0' failed. ./AS_REZ/GapFillREZ.c:8339: "ERROR: Negative variance for chunk %d in scaffold %d (AEnd=%f BEnd=%f)\n", #message
Fix: modfy the code; comment assertion statemants cat /nfshomes/dpuiu/szdevel/SourceForge/wgs/src/AS_REZ/GapFillREZ.c // assert (0.0 <= ref_variance && ref_variance <= FLT_MAX); // assert (min_right_variance >= 0.0);
- Preliminary stats
cat rezlog/rez.i36.log | grep -B 1000000 "^Scaffold Edges" | grep ':' | p 'if(/^Scaff/) { print $sum,"\n"; $sum=0; } else { $sum+=$F[-1]}' | getSummary.pl -t scf
cat rezlog/rez.i36.log | grep -B 1000000 "^Scaffold Edges" | grep ':' | grep -v Scaff | getSummary.pl -i 8 -t ctg
cat rezlog/rez.i36.log | grep -B 1000000 "^Scaffold Edges" | grep ':' | grep -v Scaff | getSummary.pl -i 8 -min 200 -t ctg200+
cat rezlog/rez.i36.log | grep -B 1000000 "^Scaffold Edges" | grep ':' | p 'if(/^Scaff/) { print $count-1,"\n"; $count=0; } else { $count++}' | getSummary.pl -i 0 -min 1 -t scf.gaps
#7-0-CGW/rez.i36.log : . elem min q1 q2 q3 max mean n50 sum scf 1820 84 162 4583 82337 3161523 125884.07 667487 229109005 # ids from 0..13113 ctg 26453 64 962 3756 10485 255820 8759.59 21800 231717378 ctg200+ 23343 200 1760 4772 11873 255820 9908.34 21845 231290344 scf.gaps 877 1 4 12 36 373 27.71 64 24298
#7-2-CGW/rez.i01.log : . elem min q1 q2 q3 max mean n50 sum scf 4903 66 1283 6908 39466 1148626 47212.57 209756 231483215 ctg 23480 64 1370 4397 11757 255820 9858.75 23476 231483360
7-2-CGW/rez.i06.log . elem min q1 q2 q3 max mean n50 sum scf 3818 64 268 6813 61948 1198480 60723.65 257457 231842914 ctg 24005 64 1165 4161 11439 255820 9659.47 23819 231875677
#7-2-CGW/rez.i11.log . elem min q1 q2 q3 max mean n50 sum scf 3733 64 268 6880 65584 1391034 62111.99 258823 231864045 ctg 24004 64 1165 4161 11439 255820 9659.98 23819 231878256
#7-2-CGW/stone.i02.log . elem min q1 q2 q3 max mean n50 sum scf 1854 83 153 4039 52506 2983045 125375.58 860583 232446325 ctg 23863 64 674 3833 11368 255820 9761.94 25892 232949194
. elem min q1 q2 q3 max mean n50 sum scf 1847 84 152 4440 62397 3337984 125470.25 835387 231743549 ctg 26088 64 429 3213 10218 297786 8941.40 25521 233263147
- TigStore
tigStore -g asm.gkpStore -t asm.tigStore/ 32 -D unitigs | tail maID isPresent isDeleted ptID svID fileOffset covStat 60970540 1 0 0 3 58023924696 84
tigStore -g asm.gkpStore -t asm.tigStore/ 32 -D contigs | tail -1 maID isPresent isDeleted ptID svID fileOffset 61001100 1 0 0 32 16307420
- Checkpoints
# 7-0-CGW
#times iterMax
CHECKPOINT_AFTER_BUILDING_SCAFFOLDS "ckp01-ABS"
CHECKPOINT_DURING_CLEANING_SCAFFOLDS "ckp02-DCS" 5 10
CHECKPOINT_AFTER_CLEANING_SCAFFOLDS "ckp03-ACD" 1
CHECKPOINT_DURING_1ST_SCAFF_MERGE "ckp04-1SM-partial" 12 # we should see more iterations if the scaffolding goes well; also ECR would take longer
CHECKPOINT_AFTER_1ST_SCAFF_MERGE "ckp05-1SM" 1
CHECKPOINT_AFTER_STONES "ckp06-AS"
CHECKPOINT_DURING_2ND_SCAFF_MERGE "ckp07-2SM-partial"
CHECKPOINT_AFTER_2ND_SCAFF_MERGE "ckp08-2SM" 1
CHECKPOINT_AFTER_FINAL_ROCKS "ckp09-FR" 1
# 7-2-CGW
#times iterMax
CHECKPOINT_AFTER_BUILDING_SCAFFOLDS "ckp01-ABS"
CHECKPOINT_DURING_CLEANING_SCAFFOLDS "ckp02-DCS" 9 10
CHECKPOINT_AFTER_CLEANING_SCAFFOLDS "ckp03-ACD" 1
...
CHECKPOINT_DURING_1ST_SCAFF_MERGE "ckp04-1SM-partial" 10
CHECKPOINT_AFTER_1ST_SCAFF_MERGE "ckp05-1SM" 1
CHECKPOINT_AFTER_STONES "ckp06-AS" 1
CHECKPOINT_DURING_2ND_SCAFF_MERGE "ckp07-2SM-partial" 1
CHECKPOINT_AFTER_2ND_SCAFF_MERGE "ckp08-2SM" 1
CHECKPOINT_AFTER_FINAL_ROCKS "ckp09-FR" 1
...
CHECKPOINT_AFTER_PARTIAL_STONES "ckp10-PS" 1
CHECKPOINT_AFTER_FINAL_CONTAINED_STONES "ckp11-FCS"
CHECKPOINT_AFTER_FINAL_CLEANUP "ckp12-FC"
CHECKPOINT_AFTER_RESOLVE_SURROGATES "ckp13-RS"
CHECKPOINT_AFTER_OUTPUT "ckp14-FIN"
- Long running time : implemented 2 cgw options -ic, -im ....
- Running times
CGW-0: START Wed Apr 28 22:30:12 ; END Mon May 3 03:34:57 ECR-1: START Mon May 3 03:34:58 ; END Mon May 3 12:28:54 CGW-2: START Mon May 3 12:28:54 ; End Wed May 12 22:05:00
- Library insert histograms
# Example cat 7-0-CGW/stat/scaffold_final.distlib_1.cgm | p 'print int($F[0]/1000),"\n";' | count.pl | sort -n > 7-0-CGW/stat/scaffold_final.distlib_1.cgm.hist cat 7-0-CGW/stat/scaffold_final.distlib_2.cgm | p 'print int($F[0]/1000),"\n";' | count.pl | sort -n > 7-0-CGW/stat/scaffold_final.distlib_2.cgm.hist gnuplot set xrange [0:10] plot "scaffold_final.distlib_1.cgm.hist" w l, "scaffold_final.distlib_2.cgm.hist" w l,
- Failure:
- after 7-2-CGW/asm.ckp.42 (after running about 2hrs)
tail runCA.log
* Screwed up scaffold 3790: Chunk 60994012 has bad mean * Scaffold 3790 iteration 1 1 bad CIs out of 33 LSE:2664.55 improvement:1 * Reinserting chunk 60994012 in scaffold 3790 * improvement = 0.0721104 LSE = 2664.55
---------------------------------------- Failure message: scaffolder failed
ECR
- Count scaffold gaps : total/closed
cat 7-1-ECR/extendClearRanges-scaffold.*.err | grep -c '^examining gap' # 24635 cat 7-1-ECR/extendClearRanges-scaffold.*.err | grep -c '^closed gap' # 2803
Terminator
- Get id range
grep -m 1 ^7 asm.posmap.utglen asm.posmap.ctglen asm.posmap.deglen asm.posmap.scflen asm.posmap.utglen:7180000000000 124 asm.posmap.deglen:7180001635156 133 asm.posmap.ctglen:7180001635158 124 asm.posmap.scflen:7180002817601 161 => utg: 7180000000000..7180001635155 ctg/deg:7180001635156..7180002817600 scf:7180002817601..7180002819521
Stats
- Assembly stats
. elem min q1 q2 q3 max mean n50 sum scf 1921 65 148 3389 55043 3122263 149121.08 982222 286461602 ctg 91934 64 100 119 180 255828 2621.59 25123 241013378 deg 1090511 54 103 124 152 7068 139.41 135 152024633 utg 1635156 54 97 118 141 94720 267.81 1636 437917658
- Assembly stats(100bp+)
elem min max mean n50 sum contigs(>100) 69270 100 255828 3451 25383 239118680 scaffolds(span) 1870 100 3122263 153185 982222 286457118 scaffolds(len) 1870 100 2990211 128880 870182 241007381
Location
ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo/ # original assembly /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo # backup
CA s_1, 2 partial ,3..8 corr OBT (CBCB) **
Issues
- Use only s_2 lib reads which seem 8K apart : ~ 14% of the s_2 reads aligned by soap2 to SOAPdenovo Illinois assembly within 8+-2Kbp of one another
- Alignments (very similar results)
soap2-index Bimp.fasta # soap2-index -> 2bwt-builder bowtie-build Bimp.fasta Bimp.fasta
soap2 -D Bimp.fasta.index -a s_2.1.fastq -b s_2.2.fastq -l 32 -p 8 -v 2 -m 6000 -x 10000 -o s_2.mated.soap2 -2 s_2.single.soap2 bowtie Bimp.fasta -1 s_2.1.fastq -2 s_2.2.fastq -l 32 -p 8 -n 2 -I 6000 -X 10000 > s_2.mated.bowtie
bowtie Bimp.fasta s_2_0.fastq -l 32 -p 8 -n 2 > s_2_0.bowtie wc -l s_2.mated.* 288880 s_2.mated.soap2 288668 s_2.mated.bowtie intersect.pl s_2.mated.* 288368
runCA spec
doExtendClearRanges=0
Input
- Gatekeeper: same as prev assembly
- Overlaps: filter out all overlaps for most of the s_2 reads
Bog
cat 4-unitigger/asm.cga.0 | perl ~/bin/cga2utgLen.pl | getSummary.pl -i 0 -j 1 elem min q1 q2 q3 max mean n50 sum 61930057 47 85 150 150 113529 125.85 150 7793894671 # max went up from 93191->113529
Bog consensus
- Failures
grep FAILED 5-consensus/asm*err : 113 unitigs between 5.. 33547 frags 5-consensus/asm_090.err:MultiAlignUnitig()-- Unitig 62979707 FAILED. Could not align fragment 264046761.
- Fix:
grep FAILED 5-consensus/asm*err | p 'print "$F[2]\n";' | perl ./fixLayout.pl | scheduler.pl grep -c FAILED 5-consensus/*err | grep -v ':0$' | p '/(.+).err/; print "touch $1.success\n";' | sort -u | scheduler.pl
Cgw
- Preliminary stats
#7-0-CGW/stone.i02.log . elem min q1 q2 q3 max mean n50 sum scf 1847 84 152 4440 62397 3337984 125470.25 835387 231743549 ctg 26088 64 429 3213 10218 297786 8941.40 25521 233263147
cat 7-0-CGW/cgw.out ... Processed 61,930,044 unitigs with 301,738,113 fragments
Terminator
- Message counts
CTP 91502 SCF 1896 CLK 3288923
cat CLK.asm | grep ^ori: | count.pl ori:O 979139 ori:A 869982 ori:N 857732 ori:I 582070
Stats
- Assembly stats
. elem min q1 q2 q3 max mean n50 sum scf 1896 76 150 4044 67922 4021294** 151760 1017298** 287738041 ctg 92307 63 100 119 186 297795** 2612.99 24781** 241197400 deg 1086650 54 103 124 152 6822 139.41 135 151484589 utg 1574225 54 98 119 143 123354 274.33 2027 431859732
- Assembly stats(100bp+)
. elem min max mean n50 sum contigs(>100) 69944 100 297795 3421 25048 239324761 scaffolds(span) 1869 100 4021294 153951 1017298 287735536 scaffolds(len) 1869 100 3429736 128833 860270 240790206
- Library stats
. badLong badOuttie badSame bothChaff bothDegen bothSurrogate diffScaffold good oneChaff oneDegen oneSurrogate HWI-EAS385_0001:1 0.15 0.06 0.01 19 10.18 0 0.45 46.9 21.41 1.59 0.19 HWI-EAS385_0001:2 0.13 0.01 0 84.86 0.02 0 0.27 14.2 0 0.36 0.02 HWI-EAS385_0001:3 0.06 0.01 0 14.45 9.03 0.04 0.05 60.11 15.17 0.68 0.16 HWI-EAS385_0001:5 0.06 0.01 0 14.84 8.93 0.04 0.05 59.98 15.02 0.65 0.16 HWI-EAS385_0001:6 0.06 0.01 0 14.76 9.04 0.04 0.05 59.7 15.29 0.65 0.16 HWI-EAS385_0001:7 0.06 0.01 0 14.73 9.12 0.04 0.05 59.51 15.44 0.64 0.16 HWI-EAS385_0001:8 0.06 0.01 0 14.05 10.1 0.03 0.05 58.66 15.92 0.7 0.16
- Issues
- Gap sizes vary between -297,562 bp and 772,064 bp. They should be no longer than ~ 8Kbp (max insert size)
cat 9-terminator/split/SCF.asm | grep -A 3 "^{CTP" | grep ^mea: | sed 's/mea://' | sort -n | head
-297562
-216729
...
162239 # scf7180002754932.314143..476382 : 26 s_1,3,5,6,7 mate pairs link the two sides of the gap
772064 # scf7180002754479.867224..1639288 : 2 s_1 mate pairs link the two sides of the gap
~/bin/posmap2scaff.pl 9-terminator/asm.posmap.ctgscf | grep -v "^>" | sort -nk4 | tail 7180002653372 EB 89 69161 7180002699293 EB 78 92310 7180002731234 BE 64936 162239 7180002726839 BE 46924 772064
grep ^mea: SCF.asm | sed 's/mea://' | getSummary.pl -i 0 -t scf.gap | pretty . elem min q1 q2 q3 max mean n50 sum scf.gap 91502 -297562 19 222 667 772064 -141 772064 -12910029 scf.gap- 13788 -297562 -2166 -89 -12 0 -4284 0 -59071991 scf.gap+ 77699 0 84 325 775 772064 594 1194 46161963
Location
mulberry:/scratch0/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/ # original (to be deleted) /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/ # backup
Other
SOAPdenovo on CA contigs
cat asm.ctg.fasta | ~/bin/assignFastaIds.pl | awk '{print $1}' > asm.contig
lenseq asm.contig > asm.contig.len
echo Edge_num `wc -l asm.contig.len` `wc -l asm.contig.len` > asm.ContigIndex
echo "index length reverseComplement" >> asm.ContigIndex
lenseq asm.K31.contig | awk '{print $1,$2,1}' >> asm.ContigIndex
SOAPdenovo map -s SOAPdenovo.config -g asm > SOAPdenovo.log # ok SOAPdenovo scaff -g asm -F >> SOAPdenovo.log # fails: a nucmer of files are missing
Assembly comparison
CA.contigs vs SOAPdenovo.contigs
- Filter contigs >=100 bp
- Alignment
nucmer --mum -c 100 CA.fasta SOAPdenovo.fasta show-coords -H /scratch0/Bombus_impatiens/Assembly/CA-vs-SOAPdenovo.contigs/CA-vs-SOAPdenovo.filter-q.delta | p ' $F[19]="." unless($F[19]); print $F[19],"\n";' | count.pl | pretty -o [CONTAINS] 80413 [CONTAINED] 4646 [IDENTITY] 1960 [BEGIN] 4152 [END] 4034 . 157 # partial alignments
# get "broken" contigs
show-coords -H /scratch0/Bombus_impatiens/Assembly/CA-vs-SOAPdenovo.contigs/CA-vs-SOAPdenovo.filter-q.delta | grep -v '\[' | awk '{print $18,$12}' | sort -u | getSummary.pl -i 1 -t all
show-coords -L 500 -H /scratch0/Bombus_impatiens/Assembly/CA-vs-SOAPdenovo.contigs/CA-vs-SOAPdenovo.filter-q.delta | grep -v '\[' | awk '{print $18,$12}' | sort -u | getSummary.pl -i 1 -t 500+
. elem min q1 q2 q3 max mean n50 sum
all 118 155 4630 9817 29042 144499 22498.97 54311 2654878
500+ 16 1844 8205 16551 28426 66880 20514.88 28426 328238
- Location
mulberry:/scratch0/Bombus_impatiens/Assembly/CA-vs-SOAPdenovo.contigs
CA.contigs vs SOAPdenovo.scaffolds
- All ctgs & scf
- Alignment
#ref/qry all
. elem min q1 q2 q3 max mean n50 sum
SOAPdenovo.scf(span) 12473 100 113 144 498 5933710 20428 1086614 254800874
SOAPdenovo.scf(len) 12473 100 113 143 341 5522831 18759.84 1034925 233991535
CA.ctg 92307 63 100 119 186 297795 2612 24781 241197400
#best hits nucmer --mum -c 40 CA.fasta SOAPdenovo.fasta delta-filter -1 40 -i 95 -o 50 -1 SOAPdenovo-vs-CA.40.delta >! SOAPdenovo-vs-CA.40.filter-1.delta
Genbank submission
- Project registration : http://www.ncbi.nlm.nih.gov/genomes/mpfsubmission.cgi
http://www.ncbi.nlm.nih.gov/genomes/mpfsubmission.cgi?show=20FF4536-24A4-4D8C-94FA-0755E1326E33 Project ID: 61101
Submitting Organization: University of Illinois & University of Maryland Sequencing Center: Keck Center for Comparative and Functional Genomics, University of Illinois ??? BCUI ??? Biotechnology Center, Univ. Illinois (BCUI) Consortium Name: Organism Name: Bombus impatiens Strain/isolate/breed: Locus Tag Prefix: BIMP #3+ letters Source of DNA used for sequencing: haploid males Sequencing Method: wgs ??? Sequencing Technology: Illumina Estimated Genome Size: 250Mb # the haploid genome size Brief description of the importnace: #2 pollinator in the US Comments to the staff: DNA whole genome sequencing single genome; no annotation assembly name BIMP_1.0 assembly method: Celera Assembler 6.1 plan to update: ? expect to release agp:
- Sequin:
Manuscript: Authors: Hugh Robertson, Matt Hudson, Kim Walden, Aarti Venkat, Tom Newman, Daniela Puiu, Tanja Magoc, David Kelley, Aleksey Zimin, Steven Salzberg, Gene Robinson
- Best assembly (CA)
/fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/ ftp://ftp.cbcb.umd.edu/pub/data/assembly/Bombus_impatiens/Assembly/CA/
. elem min q1 q2 q3 max mean n50 sum ctg 92307 63 100 119 186 297795 2613 24781 241197400 ctg.contam 82 1331 10485 19924 31977 112638 25648 32851 2103095 ctg.clean 92225 63 100 119 185 297795 2593 24628 239094305 ctgNs 76 75 536 3124 6834 44990 5326 10261 404781
scf 1896 76 150 4044 67922 4021294 151761 1017298 287738041 scf.ctg.contam 24 14315 45008 71878 141921 1116872 141140 164885 3387362
deg 1086650 54 103 124 152 6822 139 135 151484589 deg.contam 1129 65 114 141 207 1035 198 211 223588 deg.clean 1085521 54 103 124 152 6822 139 135 151261001 deg.Ns 37 98 145 234 426 914 313 437 11574
- Submission directory
/fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/genbank/ ~dpuiu/Bombus_impatiens.genbank/
- Contaminant list: ???
/fs/szattic-asmg4/tmagoc/bees_bacteria/IDs
- NCBI email (Dec 23rd)
there are 3 contigs that need to be trimmed:
Contig name Length Span(s) Apparent source 7180002728824 11695 72..148 Escherichia coli 7180002730077 25748 22703..25611 Escherichia coli 7180002740828 30102 134..1688 Escherichia coli
Since these are internal hits, consider whether the contig needs to split (if the E.coli was the 'joining' element).