Kalanchoe: Difference between revisions

From Cbcb
Jump to navigation Jump to search
No edit summary
 
Line 37: Line 37:
   /fs/szattic-asmg7/Kalenchoe_genome/rawreads/Illumina/
   /fs/szattic-asmg7/Kalenchoe_genome/rawreads/Illumina/
   /fs/szattic-asmg7/Kalenchoe_genome/rawreads/correctlyMatedIllumina/
   /fs/szattic-asmg7/Kalenchoe_genome/rawreads/correctlyMatedIllumina/
  /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Data/IlluminaTrimmedMatedCor/


= Assembly =
= Assembly =

Latest revision as of 14:50, 15 June 2011

Data

  • 300M genome
  • ~5x 454 from a variety of library sizes
  • ~20x illumina (Illumina scale qualities).
  • Location:
 /fs/szattic-asmg7/Kalenchoe_genome/

454

  • Read stats
 LIB          reads  mates       meaIns          stdIns          20mers                  ids                       
 fff01.frg.gz 545792 0                                           AT                      GLMTKIY01
 fff02.frg.gz 459461 0                                           AT                      GLMTKIY02
 fff03.frg.gz 477691 0                                           AC                      GLZRKVN01
 fff04.frg.gz 610848 0                                           AAACCCTAAACCCTAAACCCTA  GKFZ9MZ01
 fff05.frg.gz 450912 0                                           AAAACCCATAAAGTTGTTATTT  GKFZ9MZ02
 fff06.frg.gz 548462 0                                           AACAAGGCACACAGGGGATAGG  GKH094001

 fff11.frg.gz 418299 118317      20k,17072       4268            CG                      GMF8K3302    
 fff12.frg.gz 807808 273276      8k,6609         1652            AT                      GK7ZAL002    
 fff13.frg.gz 638072 205830      8k,6571         1642            ACGTACGTACGTACGTACGTAC  GLC77YN02    
 fff14.frg.gz 771593 231598      3k,2749         687             AT                      GK7ZAL001    
 fff15.frg.gz 634113 165697      3k,2768         692             AT                      GLC77YN01    
  • linker issues
'titanium' == TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG and
              CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
  • Locations
 /fs/szattic-asmg7/Kalenchoe_genome/rawreads/FFF/
 /fs/szattic-asmg7/Kalenchoe_genome/rawreads/FFFp/

Illumina

  • 7 libs, 250 bp insert size
  • trimmed all reads to 64bp
  • Location
 /fs/szattic-asmg7/Kalenchoe_genome/rawreads/Illumina/
 /fs/szattic-asmg7/Kalenchoe_genome/rawreads/correctlyMatedIllumina/
 /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Data/IlluminaTrimmedMatedCor/

Assembly

  • CA.454
 .                        elem     min  q1    q2    q3    max     mean  n50    sum
 scf                      29225    235  1161  1449  3293  233867  5972  22778  174536065
 ctg                      65154    64   1160  1502  2240  19244   1931  2133   125781315
 deg                      279542   62   302   452   579   6662    461   534    129007100
  • SOAPdenovo.Illumina
 .                        elem     min  q1    q2    q3    max     mean  n50    sum
 scf                      320855   100  141   275   590   56087   716   1987   229678477
 ctg                      3630647  32   34    50    79    21193   97    143    352876334

 scf2                     320855   100  141   269   579   56087   709   1993   227485865
 ctg2                     333643   33   138   260   560   45815   680   1873   226926306
 shreds2                  690592   1    139   270   610   2000    524   1107   362212087
  • CA.454.IlluminaShreds
 .                        elem     min  q1    q2    q3    max     mean  n50    sum
 scf                      26334    187  1200  1610  3603  583607  8703  43384  229194795
 ctg                      55625    64   1262  1975  3990  70870   3575  5949   198884011
 deg                      251480   64   267   437   560   17662   442   527    111232984
  • Locations
 /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454/
 /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/SOAPdenovo.Illumina/
 /fs/szattic-asmg7/dpuiu/Kalenchoe_genome/Assembly/CA.454.IlluminaShreds/
  • Ftp Location:
 ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/
 ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/README