Trace formatting: Difference between revisions

From Cbcb
Jump to navigation Jump to search
Dpuiu (talk | contribs)
No edit summary
Dpuiu (talk | contribs)
Line 5: Line 5:
Anomalies:  
Anomalies:  
   * homopolymer lengths can be shorter than real
   * homopolymer lengths can be shorter than real
Accuracy:
  * published per-base accuracy of a Roche GS20 is only 96%.
  * Mitch Sogin paper
    *  99.5% accuracy rate in unassembled sequences
    * identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better


== 454 (paired ends) ==
== 454 (paired ends) ==

Revision as of 14:32, 21 January 2008

Sanger

454 (single reads)

Anomalies:

 * homopolymer lengths can be shorter than real

Accuracy:

 * published per-base accuracy of a Roche GS20 is only 96%.
 * Mitch Sogin paper
   *  99.5% accuracy rate in unassembled sequences
   * identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better

454 (paired ends)

Features:

 * approximately 84-nucleotide DNA fragments 
 * have a ~ 44-mer linker sequence in the middle 
 * flanked by a ~ 20-mer sequence on each side. 
 * The two flanking 20-mers are segments of DNA that were originally located approximately 2.5 kb apart in the genome of interest.  
 * The ordering and orienting of contigs generates scaffolds which provide a high-quality draft sequence of the genome.

Anomalies:

 * the linker can appear (tandem,completely/partially) more than once

Links:

 1_paired_end.pdf

Solexa/Illumina

Links:

 Strep suis Solexa data set for download at Sanger
 NCBI Solexa example data set
 ismb2007Poster.pdf
 Smith_Rennes_2007.pdf

Software:

 Staden & Io_lib
 * IO_LIB package /fs/sz-user-supported/common/packages/io_lib-1.11-x86_64/bin/
 * STADEN package /fs/sz-user-supported/common/packages/staden-src-1-7-0/distrib/unix-rel-1-7-0/linux-bin

Example:

 $ solexa2srf s_8_0100_seq.txt  -o s_8_0100_seq.srf
 $ srf2fastq s_8_0100_seq.srf

   @s_8_100_293_551
   CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACC
   +
   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
   @s_8_100_35_698
   TATATGATTGACAATATAAAAATATGAGTATAAAAT
   +
   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII4/:I
   @s_8_100_880_947
   TTATTATCTTTATTGACGTACCTCTAGAAGACCCAA
   +
   IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII;>1
   ...