Bumblebee: Difference between revisions

From Cbcb
Jump to navigation Jump to search
Dpuiu (talk | contribs)
Dpuiu (talk | contribs)
Line 52: Line 52:
   ...
   ...
   cat  s_1_*_sequence.*.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 -minLen 64 >  s_1_sequence.clv
   cat  s_1_*_sequence.*.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 -minLen 64 >  s_1_sequence.clv
* Stats
  .                    elem      <=64      >64        min    q1    q2    q3    max        mean      n50        sum
  orig                69888198  0          69888198  124    124    124    124    124        124        124        8666136552
  clq                  69888198  7724022    62164176  0      89    111    124    124        96.76      117        6762346722
  clv                  69888198  18607136  51281062  0      0      124    124    124        86.96      124        6077231064
  clr                  69888198  24677952  45210246  0      0      88    115    124        67.31      113        4704368689


* Location:
* Location:

Revision as of 20:55, 8 March 2010

Data

  • ~ 500B genome

Traces

  • 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
 Lane   Insert            ReadLen    #Reads       Coverage    Comments
 1      3K(2..6,avg 4K)   124        34,944,099   14X
 2      8K(7..9,avg 8K)   124        32,540,640   13X

 3      500(450..600)     124        34,745,750               # gDNA
 5      500                          34,601,239
 6      500                          34,553,857
 7      500                          34,682,612
 8      500                          12,975,839
  • Adaptors
 >circularizarion
 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 >circularizarion.revcomp
 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG 
 >5
 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
 >3
 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Tasks to figure out

  1. Erroneous reads/bases, which we need to correct or discard
  2. GC bias, so we can compute a-stats properly
  3. Redundancy in the long paired ends, which are lane 1 and lane 2.
  • Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
    • Some reads will begin in the circularization adaptor and thus will have only one usable read
    • Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
    • Most reads will have at least 36bp from each end before hitting the adaptor.
    • Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)

Trimming

  • Quality plots
  • Keep only the first 100bp (last 24 bp are anyway low qual) otherwise gatekeeper "Seg fault"
  • Adaptor trimming:
    • Split data set in 1M read subsets
    • Quality trimming
  cat s_1_*_sequence.*.txt | ~/bin/fastq2clb.pl >  s_1_sequence.clb
    • Vector trimming: Align all subsets to adaptors
  nucmer -l 8 -c 16 -b 8 -g 8 adaptors.seq s_1_1_sequence.00.seq -p s_1_1_sequence.00
  delta-filter -l 16 -q  s_1_1_sequence.00.delta >  s_1_1_sequence.00.filter-q.delta
  ...
  cat  s_1_*_sequence.*.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 -minLen 64 >  s_1_sequence.clv
  • Stats
 .                    elem       <=64       >64        min    q1     q2     q3     max        mean       n50        sum
 orig                 69888198   0          69888198   124    124    124    124    124        124        124        8666136552
 clq                  69888198   7724022    62164176   0      89     111    124    124        96.76      117        6762346722
 clv                  69888198   18607136   51281062   0      0      124    124    124        86.96      124        6077231064
 clr                  69888198   24677952   45210246   0      0      88     115    124        67.31      113        4704368689
  • Location:
 /fs/szattic-asmg4/Bees/Bombus_impatiens

Assembly

  • Trimming
 No OBT
 adaptors in the seqs
  • Kmers
 meryl -Dh -s 0-mercounts/asm-C-ms22-cm1 >! 22mers.hist
 Found 3136399464 mers.
 Found 379123530 distinct mers.
 Found 201257394 unique mers.
 Largest mercount is 12006651; 90 mers are too big for histogram.
 countKmers.pl
 most frequent 42mer : CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA ~ 20%  of the seqs : circularization adapter  
  • Overlapper
 #overlaps/read
 reads      0count   min    q1     q2     q3     max        mean       n50        sum            
 62164168   21589472 0      0      4      12     324        11.42      38         709902310      


  • Unitigger : max utg len=852bp
  • Consensus after unitigger : 3 out of 129 jobs failed
  • Location
 /fs/szdevel/dpuiu/SourceForge/wgs-assembler.030210/Linux-amd64/bin/runCA