Megachile rotundata: Difference between revisions
Jump to navigation
Jump to search
No edit summary |
|||
Line 34: | Line 34: | ||
== CA noOBT == | == CA noOBT == | ||
=== Gatekeeper === | |||
* ~ 74X cvg | |||
LOAD STATS | LOAD STATS | ||
7 libInput | 7 libInput | ||
Line 56: | Line 57: | ||
s_6 63780887 0 61685156 7359094156 7359012512 | s_6 63780887 0 61685156 7359094156 7359012512 | ||
s_7 62604353 0 60479498 7222615270 7222537214 | s_7 62604353 0 60479498 7222615270 7222537214 | ||
=== Meryl === | |||
meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 | more | |||
Found 30567166217 mers. | |||
Found 268251409 distinct mers. | |||
Found 9679077 unique mers. | |||
Largest mercount is 87908217; 1896 mers are too big for histogram. | |||
1 9679077 0.0361 0.0003 | |||
2 8374869 0.0673 0.0009 | |||
3 2494762 0.0766 0.0011 | |||
... | |||
54 5310305 0.6544 0.1789 | |||
... | |||
1047970 1 1.0000 0.6652 | |||
* Location | * Location | ||
mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT | mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT |
Revision as of 01:30, 2 September 2010
Data
Original Traces
- 8 pairs of data files (paired ends)
cat trace.count | grep _1_ | sed 's/_sequence.txt//' | perl -ane 'print " ",$F[1],"\t",$F[0]/4,"\t",$F[0]/2,"\n";'
lib insert mates reads readLen ~coverage(500M genome) reverse adaptors comments s_2_1_3kbp 3000 21563283 43,126,566 124 11 ? circularizarion s_2_1_5kbp 5000/300 36218589 72,437,178 35 5 yes ? insert size is << 5kbp s_2_1_8kbp 8000 198377 396,754 124 0.1 ? ? s_3_1 475 35548153 71,096,306 124 18 s_4_1 475 35471044 70,942,088 124 18 s_5_1 475 35616846 71,233,692 124 18 s_6_1 475 35303840 70,607,680 124 18 s_7_1 475 34893313 69,786,626 124 18
Adaptors
>circularizarion CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA >circularizarion.revcomp TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
Location
/fs/szattic-asmg5/Bees/Megachile_rotundata/error_correction/large_libs/s_?_?_?kb.sequence.cor.all.txt ftp://ftp.cbcb.umd.edu/pub/data/assembly/Megachile_rotundata/reads/s_?_?_?kb.sequence.cor.all.txt.gz
Assemblies
- CA Version: 6.1
/fs/szdevel/dpuiu/SourceForge/wgs-6.1/Linux-amd64/bin/runCA
CA noOBT
Gatekeeper
- ~ 74X cvg
LOAD STATS 7 libInput 7 libLoaded 0 libErrors 5 libWarnings 326,236,387 frgLoaded 326236387 numRandom 326236387 numPacked LibraryName numActiveFRG numDelFRG numMatedFRG readLength clearLength GLOBAL 326236387 0 315518526 37451489553 37418130441 LegacyUnmatedReads 0 0 0 0 0 s_2_3kb 9107424 0 9107424 942165284 910444046 s_2_8kb 209336 0 209336 21814418 20787384 s_3 63618839 0 61696784 7343024554 7342819494 s_4 63544688 0 61255960 7291557748 7291478152 s_5 63370860 0 61084368 7271218123 7271051639 s_6 63780887 0 61685156 7359094156 7359012512 s_7 62604353 0 60479498 7222615270 7222537214
Meryl
meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 | more Found 30567166217 mers. Found 268251409 distinct mers. Found 9679077 unique mers. Largest mercount is 87908217; 1896 mers are too big for histogram. 1 9679077 0.0361 0.0003 2 8374869 0.0673 0.0009 3 2494762 0.0766 0.0011 ... 54 5310305 0.6544 0.1789 ... 1047970 1 1.0000 0.6652
- Location
mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT