Megachile rotundata: Difference between revisions

From Cbcb
Jump to navigation Jump to search
Line 60: Line 60:


   .      elem      min    q1    q2    q3    max        mean      n50        sum             
   .      elem      min    q1    q2    q3    max        mean      n50        sum             
   utg    1437146    64    123    143    195    67048      308.78    870        443759899       
   utg    1437146    64    123    143    195    67048      308       870        443759899       
   ctg    37494      65    2185  3998  7706  191323     6380.39    10151     239226293       
   ctg    37494      65    2185  3998  7706  191323*    6380       10151*    239226293       
   deg    1136469    64    123    143    184    5031      160.11    164        181954480       
   deg    1136469    64    123    143    184    5031      160       164        181954480       
   scf    20827      122    3228  6374  13700  202495    11508.95  20462      239696810       
   scf    20827      122    3228  6374  13700  202495    11508     20462      239696810       
   
   
   reads      72,995,448
   reads      72,995,448
Line 158: Line 158:
* Stats  
* Stats  
   .                    elem      min    q1    q2    q3    max        mean      n50        sum             
   .                    elem      min    q1    q2    q3    max        mean      n50        sum             
   contigs              9742349    31    32    33    37    114832    60.09      44        585430821       
   contigs              9742349    31    32    33    37    114832    60         44        585430821       
   contigs(>100bp)      177327    100    131    261    1398  114832    1333.68    3897      236496823    # N50 for Bee was 7K
   contigs(>100bp)      177327    100    131    261    1398  114832    1333       3897      236496823    # N50 for Bee was 7K
   scaf                7863      102    903    3272  17692  2338728    37825.70  240706    297423517    # N50 for Bee was 1.17M
   scaf                7863      102    903    3272  17692  2338728    37825     240706    297423517    # N50 for Bee was 1.17M
   
   
* Location  
* Location  
Line 172: Line 172:


   .                    elem      min    q1    q2    q3    max        mean      n50        sum             
   .                    elem      min    q1    q2    q3    max        mean      n50        sum             
   contigs(all)        6,917,796  31    32    34    40    121554    70.46      73        487,401,812       
   contigs(all)        6,917,796  31    32    34    40    121554    70         73        487,401,812       
   contigs(>100bp)      210,666    100    124    222    1174  121554    1108.69    3138      233,563,401
   contigs(>100bp)      210,666    100    124    222    1174  121554    1108       3138      233,563,401
   scaff                25,119    351    1896  4444  10914  1102803    11041.00  26876      277,338,897
   scaff                25,119    351    1896  4444  10914  1102803    11041     26876      277,338,897


   reads                340,437,486
   reads                340,437,486

Revision as of 18:09, 7 September 2010

Data

Original Traces

  • 8 pairs of data files (paired ends)
 cat trace.count | grep _1_ | sed 's/_sequence.txt//' | perl -ane 'print "  ",$F[1],"\t",$F[0]/4,"\t",$F[0]/2,"\n";'
 lib        insert   mates           reads        readLen   ~coverage(500M genome)  reverse  adaptors            comments
 s_2_3kbp   3000     21,563,283      43,126,566   124       11                      ?        circularizarion
 #s_2_5kbp  5000/300 36218589        72,437,178   35        5                       yes      ?                   insert size is << 5kbp
 s_2_8kbp   8000     198377          396,754      124       0.1                     ?        ?
 s_3        475      35548153        71,096,306   124       18
 s_4        475      35471044        70,942,088   124       18
 s_5        475      35616846        71,233,692   124       18
 s_6        475      35303840        70,607,680   124       18
 s_7        475      34893313        69,786,626   124       18
 total      .        198,594,856     397,189,712

Corrected Traces

  • Mated ones
 lib        insert   mates           reads
 s_2_3kb    3000     4,823,235       9,646,470   
 s_2_8kb    8000     111,267         222,534    
 s_3        475      33,024,597      66,049,194  
 s_4        475      33,237,593      66,475,186  
 s_5        475      33,150,790      66,301,580  
 s_6        475      33,223,371      66,446,742  
 s_7        475      32,647,890      65,295,780
 total      .        170,218,743     340,437,486

Adaptors

 >circularizarion
 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 >circularizarion.revcomp
 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG 

Location

 /fs/szattic-asmg5/Bees/Megachile_rotundata/error_correction/large_libs/s_?_?_?kb.sequence.cor.all.txt
 /fs/szattic-asmg5/Bees/Megachile_rotundata/error_free/s_?_?_sequence.cor.txt
 /fs/szattic-asmg5/Bees/Megachile_rotundata/frg/  # frg files to assemble

Assemblies

  • CA Version: 6.1 (09/01/2010) /fs/szdevel/dpuiu/SourceForge/wgs-6.1/Linux-amd64/bin/runCA
  • SOAP version 1.04: /nfshomes/dpuiu/szdevel/SOAPdenovo_Release1.04/

CA noOBT partial

  • Data : 3 libraries
 LibraryName           numActiveFRG  numDeletedFRG  numMatedFRG  readLength  clearLength  
 GLOBAL                72995448      0              70632632     8307194830  8278360381   
 LegacyUnmatedReads    0             0              0            0           0            
 s_2_3kb               9166343       0              8736228      942501164   914798596    
 s_2_8kb               210266        0              199620       21669112    20742291     
 s_3                   63618839      0              61696784     7343024554  7342819494   
  • Stats
 .       elem       min    q1     q2     q3     max        mean       n50        sum            
 utg     1437146    64     123    143    195    67048      308        870        443759899      
 ctg     37494      65     2185   3998   7706   191323*    6380       10151*     239226293      
 deg     1136469    64     123    143    184    5031       160        164        181954480      
 scf     20827      122    3228   6374   13700  202495     11508      20462      239696810      

 reads       72,995,448
 singletons  34,881,692 (47%)
  • Locations
 ginkgo:/scratch1/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial/
 Moved  from
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial/

CA noOBT

Gatekeeper

  • ~ 74X cvg
 LibraryName           numActiveFRG  numDelFRG  numMatedFRG  readLength   clearLength    #repeats                                                                                                                                                              
 GLOBAL                326,236,387   0          315518526    37451489553  37418130441  
 LegacyUnmatedReads    0             0          0            0            0            
 s_2_3kb               9107424       0          9107424      942165284    910444046      #
 s_2_8kb               209336        0          209336       21814418     20787384       #
 s_3                   63618839      0          61696784     7343024554   7342819494     #
 s_4                   63544688      0          61255960     7291557748   7291478152     #
 s_5                   63370860      0          61084368     7271218123   7271051639     #
 s_6                   63780887      0          61685156     7359094156   7359012512     #
 s_7                   62604353      0          60479498     7222615270   7222537214     #

Meryl

 meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 
 Found 30570218845 mers.
 Found 271464470 distinct mers.
 Found 11164787 unique mers.
 Largest mercount is 87984949; 1896 mers are too big for histogram.
 1       11164787        0.0411  0.0004
 2       9376915         0.0757  0.0010
 3       3714582         0.0894  0.0013
 ...
 54      5344148         0.6573  0.1788
 ... 
 fasta2tab.pl 0-mercounts/asm.nmers.ovl.fasta | sort -n -r | head -5
 87,908,217        AATCATACAATCACAATCATAC
 84,450,288        CAATCATACAATCACAATCATA
 ...
 74,975,282        AATAATATGAGTTAGATTGATA
 egrep -c 'AATCATACAATCACAATCATAC|GTATGATTGTGATTGTATGATT' *fastq *txt > egrep.count
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Data/error_free/egrep.count
 meryl -Dh -s 0-mercounts/asm-C-ms15-cm0 | head
 Found 32850820919 mers.
 Found 142500876 distinct mers.
 Found 2381895 unique mers.
 Largest mercount is 125816941; 2023 mers are too big for histogram.
 1       2381895 0.0167  0.0001
 2       2325770 0.0330  0.0002
 3       708786  0.0380  0.0003
 ...
 54      1851586 0.4894  0.0671
...

Overlap

  • job count :
 cat 1-overlapper/ovlopts.pl | grep ^\"h | wc -l
 924
  • Failures: 709 jobs failed; runCA 6.1 could not restart overlap properly !!!
 cat 1-overlap/overlap*out | grep "^Could not" | sort -u
 Could not malloc memory (1305184948 bytes)
 cat 1-overlapper/*pl | grep ^\"0 | sed 's/"//' | sed 's/\",//' >! 1-overlapper/ovlopts.pl.0
 cat 1-overlapper/*pl | grep ^\"h | sed 's/"//' | sed 's/\",//' >! 1-overlapper/ovlopts.pl.h
 cat 1-overlapper/*pl | grep ^\"-h | sed 's/"//' | sed 's/\",//' >! 1-overlapper/ovlopts.pl.-h

 paste 1-overlapper/ovlopts.pl.* | p 'print "overlap -M 8GB --hashload 0.8 -t 1 -h $F[3]  -r $F[5] -k 22 -k  \
       ./0-mercounts/asm.nmers.ovl.fasta  -o ./1-overlapper/$F[0]/$F[1].ovb.gz ./asm.gkpStore > \
       ./1-overlapper/overlap.0$..out \n";' | tail -709 > overlap.sh
  • Stats
 overlapStore -d asm.ovlStore | awk '{print $1}' | uniq -c | awk '{print $1}' | count.pl | getSummary.pl -i 0 -j 1
 overlapStats -G asm.gkpStore -O asm.ovlStore -o asm

Location

 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT

SOAPdenovo (Tanja)

 cat *.ContigIndex | grep -v ^E | grep -v ^i | count.pl -i 1 | getSummary.pl -j 1 -t "contigs"
 cat *.ContigIndex | grep -v ^E | grep -v ^i | count.pl -i 1 | getSummary.pl -j 1 -min 100 -t "contigs(>100bp)"
 grep "^>" *.scaf | getSummary.pl -i 2 -t scaf
  • Stats
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 contigs              9742349    31     32     33     37     114832     60         44         585430821      
 contigs(>100bp)      177327     100    131    261    1398   114832     1333       3897       236496823     # N50 for Bee was 7K
 scaf                 7863       102    903    3272   17692  2338728    37825      240706     297423517     # N50 for Bee was 1.17M

  • Location
 /fs/szattic-asmg5/Bees/Megachile_rotundata/Assembly/assembly5kbForAll

SOAPdenovo (Daniela)

  • Stats
 cat asm.K31.contig | grep "^>" | awk '{print $3}' | uniq -c | awk '{print $2,$1}'  > asm.K31.contigLen.count
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 contigs(all)         6,917,796  31     32     34     40     121554     70         73         487,401,812      
 contigs(>100bp)      210,666    100    124    222    1174   121554     1108       3138       233,563,401
 scaff                25,119     351    1896   4444   10914  1102803    11041      26876      277,338,897
 reads                340,437,486
 readsOnContigs       171,212,613 
  • Location
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/SOAPdenovo-redo