Dpuiu Assemblathon: Difference between revisions
Jump to navigation
Jump to search
Line 28: | Line 28: | ||
Location: | Location: | ||
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt | /fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt # original fastq files | ||
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/s_[ | |||
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq | /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[129]_[012]_sequence.cor.rev.txt # adaptor free corrected reads (long inserts) | ||
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt # corrected reads (short inserts) | |||
== Bacterium, Staph aureus USA300 == | == Bacterium, Staph aureus USA300 == | ||
== Human, a single chromosome, medium-sized. == | == Human, a single chromosome, medium-sized. == |
Revision as of 16:01, 14 December 2010
Links
CBCB genomes
- a bacterial genome. Instead of E. coli, we can use S. aureus USA300, which has sequence data in SRA from 454 and Illumina, paired and unpaired. Daniela has already assemblied it using CA, Newbler, Velvet, SOAPdenovo, and Maq (using its comparative assembly mode, where it aligns to a reference).
- A medium-sized eukaryote. I'd like to use the Argentine ant or the Bombus impatiens bee - I've just written to Gene Robinson to ask about the bee.
- Another eukaryote, ideally a larger one. Human would be great, but we just don't have enough time to do multiple human assemblies. So maybe another insect, or perhaps a plant if we can find one for which data is available.
If we can agree on the data sets, then the next step would be to design the experiment - decide in advance which assemblers to run and how many ways to try each one. I'm thinking we should also trim all the data with Quake.
Argentine ant
Bee, Bombus impatiens
Data
- 497,318,144 Illumina 124bp reads
- 8 libraries; inserts:
- 400bp
- 3k (outie)
- 8k (outie)
- Traces
Adapters: in 3k & 8k libraries
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA 3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
Location:
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt # original fastq files /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[129]_[012]_sequence.cor.rev.txt # adaptor free corrected reads (long inserts) /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt # corrected reads (short inserts)