Trace formatting
Sanger
454 (single reads)
454 (paired ends)
Features:
* approximately 84-nucleotide DNA fragments * have a ~ 44-mer linker sequence in the middle * flanked by a ~ 20-mer sequence on each side. * The two flanking 20-mers are segments of DNA that were originally located approximately 2.5 kb apart in the genome of interest. * The ordering and orienting of contigs generates scaffolds which provide a high-quality draft sequence of the genome.
Anomalies:
* the linker can appear (tandem,completely/partially) more than once
Links:
1_paired_end.pdf
Solexa/Illumina
Links:
Strep suis Solexa data set for download at Sanger NCBI Solexa example data set ismb2007Poster.pdf Smith_Rennes_2007.pdf
Software:
* IO_LIB package /fs/sz-user-supported/common/packages/io_lib-1.11-x86_64/bin/ * STADEN package /fs/sz-user-supported/common/packages/staden-src-1-7-0/distrib/unix-rel-1-7-0/linux-bin
Example:
$ solexa2srf s_8_0100_seq.txt -o s_8_0100_seq.srf $ srf2fastq s_8_0100_seq.srf @s_8_100_293_551 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACC + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII @s_8_100_35_698 TATATGATTGACAATATAAAAATATGAGTATAAAAT + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII4/:I @s_8_100_880_947 TTATTATCTTTATTGACGTACCTCTAGAAGACCCAA + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII;>1 ...
Assembly Formats
ace