Pseudodomonas syringae
Jump to navigation
Jump to search
Pseudomonas syringae pv. tomato str. DC3000
Data
Originally sequenced and finished at TIGR: published Sept 2003
NCBI
AA: no assembly TA 80,959 reads Genome Project Taxonomy TaxId=223283
Chromosome + 2 plasmids:
Name Length %GC Info NC_004578.1 6,397,126 58.40 chromosome NC_004633.1 73,661 55.15 plasmid pDC3000A NC_004632.1 67,473 56.17 plasmid pDC3000B total 6,538,260
Little similarity between the chromosome and plasmids. The 2 plasmids share a significant amount of DNA; see /fs/szasmg2/Bacteria/Pseudomonas_syringae/Data/nucmer/NC_004633-NC_004632.png
UNC: Jeff Dangl
New sequence:
Read stats
Type File #reads min median max sum mean stdev n50 Solexa DC3000.reads.filtered.fasta 6,340,136 32 32 32 202884352 32 0 32 454p DC3000.format.454Reads.fna 123,992 38 86 329 15623908 126.01 58.89 142 454 DC3000.TCA.454reads.format.fna 77,466 35 244 371 18627363 240.46 26.85 245
* Solexa 3 lanes;
* 454 shotgun 1/4 Plate (250bp read);
* 454 paired ends 1/4 Plate :
* contain a 44 bp linker in the middle
* the linker sequence is: GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
* there are some (not many) 454 paired end sequences that contain multiple instances of the linker (tandem): Example EUEIEUN01ANUGL_length=128_xy=0154_1891
Quality values are missing for all data sets!!!
I assigned default qual=3 to all the base (.frg & .afg files)
UNC sequence data: (not avail any more?)
http://biology622.dhcp.unc.edu/~labweb/DCData/
UNC (e-mail):
* Theoretical minimum number of contigs we can obtain is 268 (our reads fail to cover 269 nucleotides). * Our de novo assembly spans the genome in 853 contigs totaling 6,313,026 bp. * 98.7% of the genome is covered by a contig; * 84% of the genome is covered by contigs 10,000 bp or greater. * The average gap size between contigs is 98 bp; * average contig size 7401 bp. * The N50 = 37,444 bp. * Our largest BAMBUS "scaffold" is 2,565,761 bp
Files location:
/fs/szasmg2/Bacteria/Pseudodomonas_syringae/Data /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly
Assemblies
454 AMOScmp
/fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/454/2007_1015_AMOSCmp-relaxed no trimming; AMOScmp -D MINCLUSTER=20 -D MAXTRIM=10 -D MAJORITY=50 ...
Stats: desc #elem min max mean stdev sum contigs 6131 43 8261 966.57 829.44 5926089 pos_gaps 5622 1 10394 110.32 283.78 620259 Slight improvement by doing alignment based trimming of the 454 reads
Solexa AMOScmp
/fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/2008_0116_AMOSCmp-relaxed Duplication if ALIGNWIGGLE=15
Align all reads (Solexa) to the reference using nucmer.
6340136 reads 5641782 (88.98%) aligned by nucmer -c 20 -l 20 3453618 (54.47%) aligned by nucmer -c 32 -l 20 2707005 (42.69%) aligned by nucmer -c 32 -l 32
AMOScmp -D MAJORITY=50 -D MINOVL=5 -D MINCLUSTER=20 -D ALIGNWIGGLE=2 ...
Stats: desc #elem min max mean stdev sum contigs 187 20 577910 34862.83 91691.51 6519350 pos_gaps 147 1 1716 131.05 288.69 19265
Solexa maq
/fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/2008_0213_maq/maq
Stats: desc #elem min max mean stdev sum contigs 106 32 2067205 61489.83 230284.47 6517923 pos_gaps 104 1 3278 195.54 511.06 20337
454 + Solexa AMOScmp
AMOScmp -D MINCLUSTER=20 -D MAXTRIM=20 -D MINOVL=5 -D MAJORITY=50 -D ALIGNWIGGLE=2 ...
Stats: desc #elem min max mean stdev sum contigs 139 20 1895644 46899.82 243273.92 6519075 pos_gaps 124 1 1809 156.78 323.66 19441
454 + Solexa + 454p AMOScmp
Only the 454 paired ends that contain 1 single complete adaptor sequence were used (allmost all) 149 contigs; very similar to the prev ome
Sanger AMOScmp
/fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_AMOSCmp-relaxed Many miss-oriented mates in the 4.8M-5M region of the chromosome 22 contigs Chromosome Chromosome problem
Sanger Celera 3.11
/fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1011_WGA 22 scaff, 46 contigs, 181 degens Scaffold 7180000001443 looks circular: possible 163,074 bp plasmid aligns to 4.8M-5M "problem" region in the chromosome 7180000001443.png
[S1] [E1] | [S2] [E2] | [LEN 1] [LEN 2] | [% IDY] | [LEN R] [LEN Q] | [COV R] [COV Q] | [TAGS]
===============================================================================================================================
1 175592 | 1 175592 | 175592 175592 | 100.00 | 175592 175592 | 100.00 100.00 | 7180000001443 7180000001443 [IDENTITY]
1 12519 | 163075 175592 | 12519 12518 | 99.98 | 175592 175592 | 7.13 7.13 | 7180000001443 7180000001443 [BEGIN]
163075 175592 | 1 12519 | 12518 12519 | 99.98 | 175592 175592 | 7.13 7.13 | 7180000001443 7180000001443 [END]
[S1] [E1] | [S2] [E2] | [LEN 1] [LEN 2] | [% IDY] | [LEN R] [LEN Q] | [COV R] [COV Q] | [TAGS] =============================================================================================================================== 4790727 4911492 | 120764 1 | 120766 120764 | 99.98 | 6397126 175592 | 1.89 68.78 | gi|28867243|ref|NC_004578.1| 7180000001443 4898971 4955870 | 175592 118697 | 56900 56896 | 99.98 | 6397126 175592 | 0.89 32.40 | gi|28867243|ref|NC_004578.1| 7180000001443
Sanger AMOScmp (Chromosome+3 plasmids ref)
Reference=complete genome(chromosome+3 plasmids) use "circular contig" in Celera 3.11 assembly /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids 38 contigs: 15 for main chromosome, 1 for longer plasmid, 21 for shorter plasmid, 1 for "circular contig" The missoriented read pile corresponding to the chromosome (4. AMOSCmp of Sanger reads) has dissapeared AA ready for submission: /fs/szasmg2/Bacteria/Pseudodomonas_syringae/Assembly/Sanger/2007_1012_AMOSCmp-relaxed-3plasmids/AA/umd-20071030-141700.tar.gz
Solexa assembled at different read coverages
Location: /fs/szasmg2/Bacteria/Pseudomonas_syringae/Assembly/Solexa/sample/ Several assemblies, using 10%,20%, ... 100%, of the P. syringae Solexa reads. These would correspond to 3X,6X ... 30X coverage The read sampling was done randomly. One sample set for each coverage.
Assembler: Sanger maq all contigs desc #elem min max mean stdev sum 10 43136 32 7712 135.11 140.61 5828148 20 11243 32 20190 570.01 686.5 6408705 30 2972 32 27962 2185.32 2804.56 6494784 40 1058 32 63125 6152.98 7871.7 6509855 50 455 32 163430 14319.01 19663.15 6515153 60 267 32 328882 24406.61 46172.62 6516567 70 166 32 671064 39260.9 84200.42 6517311 80 143 32 906652 45577.16 111875.19 6517535 90 117 32 1433643 55708.4 164246.61 6517883 100 106 32 2067205 61489.83 230284.47 6517923 chromo contigs desc #elem min max mean stdev sum 10 42845 32 1845 133.32 118.36 5712348 20 11124 32 9650 565.41 625.32 6289649 30 2876 32 26076 2216.64 2714.92 6375063 40 965 32 63125 6621.71 7893.19 6389957 50 362 32 163430 17665.19 20565.31 6394800 60 167 32 328882 38299.32 53660.75 6395987 70 75 257 671064 85287.52 108858.19 6396564 80 49 940 906652 130546.42 160470.1 6396775 90 25 42603 1433643 255877.72 277650.54 6396943 100 18 42603 2067205 355387.77 465907.88 6396980 all gaps desc #elem min max mean stdev sum 10 43137 1 3874 16.46 38.01 710112 20 11242 1 3919 11.52 64.43 129555 30 2971 1 3418 14.63 114.29 43476 40 1056 1 3873 26.89 196.7 28405 50 454 1 3415 50.89 291.04 23107 60 265 1 3870 81.86 380.9 21693 70 165 1 3868 126.96 486.88 20949 80 141 1 3414 146.98 461.06 20725 90 115 1 3418 177.19 520.11 20377 100 104 1 3278 195.54 511.06 20337 chromo gaps desc #elem min max mean stdev sum 10 42846 1 240 15.98 16.33 684778 20 11125 1 146 9.66 9.72 107477 30 2876 1 76 7.67 7.73 22063 40 965 1 58 7.42 7.8 7169 50 362 1 48 6.42 7.08 2326 60 167 1 58 6.82 7.63 1139 70 76 1 55 7.39 7.9 562 80 49 1 55 7.16 10.08 351 90 25 1 45 7.31 10.12 183 100 18 1 55 8.11 13.62 146
Assembler: AMOScmp
all contigs desc #elem min max mean stdev sum 10 61330 20 9181 97.08 101.04 5954113 20 18764 20 19803 343.93 431.9 6453593 30 5723 20 28103 1137.41 1498.76 6509417 40 2045 20 33780 3186.49 4337.72 6516385 50 859 20 90346 7588.66 11436.97 6518661 60 479 20 219894 13609.97 22470.18 6519176 70 319 20 289494 20436.94 37964.34 6519384 80 246 20 385663 26502.45 61309.04 6519605 90 237 20 577910 27510.48 71767.85 6519985 100 187 20 577910 34862.83 91691.51 6519350
chromo contigs desc #elem min max mean stdev sum 10 60923 20 1052 95.8 79.21 5836796 20 18583 20 4800 340.81 368.44 6333397 30 5567 22 20245 1147.53 1401.05 6388303 40 1883 20 33780 3396.09 4327.93 6394855 50 699 24 90346 9151.31 12023.55 6396771 60 313 29 219894 20437.56 25135.49 6396957 70 155 32 289494 41271.96 45893.6 6397154 80 82 28 385663 78014.63 85498.69 6397200 90 64 35 577910 99957.57 109269.83 6397285 100 40 46 577910 159930.32 139830.19 6397213
all gaps desc #elem min max mean stdev sum 10 45068 1 2228 14.89 26.44 671499 20 11034 1 3148 10.81 49.56 119340 30 2816 1 2296 16.57 106.54 46663 40 1022 1 1903 25.98 125.51 26559 50 456 1 1716 46.91 159.75 21394 60 294 1 1445 68.35 189.57 20097 70 221 1 1716 88.33 225.56 19523 80 182 1 1716 105.12 244.55 19132 90 181 1 1716 103.78 235.41 18785 100 147 1 1716 131.05 288.69 19265
chromo gaps desc #elem min max mean stdev sum 10 44767 1 197 14.45 14.86 647093 20 10884 1 1008 9.02 17.01 98181 30 2677 1 2296 9.88 70.77 26464 40 869 1 685 7.8 24.09 6786 50 303 1 59 6.55 6.88 1986 60 137 1 33 7.35 7.22 1007 70 65 1 33 6.83 6.9 444 80 27 1 36 8.37 9.74 226 90 18 1 42 8.83 11.44 159 100 10 1 33 10.7 12.58 107