Trace formatting
Articles
- The impact of next-generation sequencing technology on genetics Elaine Mardis Trends in Genetics 2008
- As Users Demand Paired-End Sequencing, 454, Illumina, and ABI Work On New Kits
- Sequence Format Descriptions(EMBL)
Technologies
Latest Technology Summary
Technology 454 Illumina Solid Latest GS Titanium Genome Analyzer II Throughput/run 500M RunTime 10hr ReadLen 500bp 51 Q20(99%accuracy) 400bp InsertLen 3K Problems homopolimers
Sanger
454 : Pyrosequencing
Anomalies:
* homopolymer lengths can be shorter than real * substitutions less likely than in traditional methodssingle base insertions * carry forward events usually near but not adjacent to homopolymers
GS20
* 1.6M total wells * 450K detactable wells * 200K usable wells
Accuracy: * published per-base accuracy of a Roche GS20 is only 96%. * Mitch Sogin paper * 99.5% accuracy rate in unassembled sequences * identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better => better quality than Sanger sequencing * The error rate, defined as the number of errors (miscalled bases plus inserted and deleted bases) divided by the total number of expected bases, was 0.49% * 36% insertions, 27% delitions, 21% N's, 16% substitutions * A to G and T to C, were more frequent than other mismatches * reverse transitions, G to A and C to T, were not that frequent * Nearly 70% of the homopolymer extensions were A/T * errors were evenly distributed along the length of the reference sequences, they were not evenly distributed
among reads: 82% had no errors, 93% had no more than a single error, and 96% had no more than 2 errors.
* A small number of reads, fewer than 2%, contained a disproportionate number of errors that account for nearly 50% of the miscalls for the entire dataset * Avg quality is 25; in homopolymers can drop as low as 5 * Reads much longer than avg length had more errors * strong correlation between the presence of ambiguous base calls and other errors in a read * The presence of even a single ambiguous base in a read correlates strongly with the presence of other errors * Primer errors also correlated with errors
GS FLX
GS Titanium
* up to 500M/run * reads up to 500bp
Get info from .sff files:
$ sffinfo -h
Usage: sffinfo [options...] [- | sfffile] [accno...]
Options:
-a or -accno Output just the accessions
-s or -seq Output just the sequences
-q or -qual Output just the quality scores
-f or -flow Output just the flowgrams
-t or -tab Output the seq/qual/flow as tab-delimited lines
-n or -notrim Output the untrimmed sequence or quality scores
-m or -mft Output the manifest text
un-paired reads
paired ends
Features:
* approximately 84-nucleotide DNA fragments * have a ~ 44-mer linker sequence in the middle * flanked by a ~ 20-mer sequence on each side. * The two flanking 20-mers are segments of DNA that were originally located approximately 2.5 (3?) kb apart in the genome of interest. * The ordering and orienting of contigs generates scaffolds which provide a high-quality draft sequence of the genome.
Linker(palindrome) : GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC Check for linker : sffinfo -s *.sff | ~/bin/fasta2tab.pl | grep GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC 12345678901234567890123456789012345678901234 GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
GTTGGAACCGA AAGGGTTTGAA TTCAAACCCTT TCGGTTCCAAC
Anomalies:
* the linker can appear (tandem,completely/partially) more than once * some reads end up in linker (partial) * some reads don't contain the linker at all * some reads are cloning vector
Links:
1_paired_end.pdf
File location:
/fs/szdata/454p/
Solexa/Illumina : Sequencing by Synthesis
Platforms:
* Genome Analyzer (GA) * Genome Analyzer II : faster, higher tput * Future: 10GB/run 50bp reads * Future: 20GB/run 100bp reads
Data sets:
Strep suis Solexa data set for download at Sanger Staphylococcus aureus strain MW2 (edena paper) NCBI Solexa example data set Pseudomonas aeruginosa Pseudomonas syringae
human HapMap individual NA12878 SRR000921..SRR001306
Articles:
ismb2007Poster.pdf Smith_Rennes_2007.pdf
Applications:
* Gene Expression * ChIPSeq (hight throughput) * Re-sequencing * mRNA sequencing
Software:
Staden & Io_lib * IO_LIB package /fs/sz-user-supported/common/packages/io_lib-1.11-x86_64/bin/ * STADEN package /fs/sz-user-supported/common/packages/staden-src-1-7-0/distrib/unix-rel-1-7-0/linux-bin MAQ Sanger assembler FASTQ sequence format
Illumina 1G :
* ~40 Million DNA sequencing reactions * about 36 hours for a run * each sequence is up to 36 bases long * insert len=~200bp
Illumina Genome Analyzer II:
* up to 51 bp * mate-pairs: opposite directions, slight overlap (insert size is less than 200bp "advertised") * on the SRA mate-pairs are joined; when downloaded only one read is shown. What about the mate pair?
SRA: set of 4 files
*_seq.txt : lane,run, well(x,y) sequence *_prb.txt : max quality from each group of 4 values is taken as quality *_sig2.txt : lane,run, well(x,y); max signal from each group of 4 values corresponds to max quality *_qhg.txt : lane,run, well(x,y); some encoded info?
# *_seq.txt 5 1 1269 1795 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA # _prb.txt 40 -40 -40 -40 40 -40 -40 -40 ... # _sig2.txt <== 5 1 1269 1795 2594.0 2367.0 -10.0 -96.0 ...
Qualities:
Range : -5..40 Avg : ~25, depending on the data set
Fastq format
Example:
1 lane of Solexa reads: 10,959 READS; all are 36 bp $ /fs/sz-user-supported/common/packages/io_lib-x86_64/bin/solexa2srf s_8_0100_seq.txt ; mv traces.srf s_8_0100.srf $ /fs/sz-user-supported/common/packages/io_lib-x86_64/bin/srf2fastq s_8_0100.srf > s_8_0100.fastq @s_8_100_293_551 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACC + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII @s_8_100_35_698 TATATGATTGACAATATAAAAATATGAGTATAAAAT + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII4/:I @s_8_100_880_947 TTATTATCTTTATTGACGTACCTCTAGAAGACCCAA + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII;>1 ...
Edge effect: N's have quality -14
$ cat s_8_0100_seq.txt | sort -nk3 -nk4 8 100 0 37 ......AT.AT...TAATCAATA..GA.GAAG.... ... 8 100 1003 959 AGTC.......T.C.........GT.........AA
$ more traces.qual ... >s_8_100_0_37 -14 -14 -14 -14 -14 -14 25 13 -14 25 25 -14 -14 -14 25 25 25 25 22 25 25 25 25 -14 -14 25 25 -14 25 -11 25 14 -14 -14 -14 -14 ... >s_8_100_1003_959 25 25 25 25 -14 -14 -14 -14 -14 -14 -14 25 -14 25 -14 -14 -14 -14 -14 -14 -14 -14 -14 25 -10 -14 -14 -14 -14 -14 -14 -14 -14 -14 8 25 ...
# bioperl script to convrt seq formats
$ seqconvert.PLS --from fastq --to fasta < s_8_0100.fastq
# get fastq qualities
$ more *fastq | grep -A 1 "^+" | grep -v ^+ | grep -v -- ^-- | perl -ane '@F=split //,$F[0]; foreach (@F) { $n=ord($_)-33; print $n," ";} print "\n";'
# convert Solexa format (maq fq_all2std.pl script) $ fq_all2std.pl seqprb2std s_5_0001_seq.txt s_5_0001_prb.txt > s_5_001.fastq $ fq_all2std.pl fq2fa s_5_001.fastq > s_5_001.seq
SOLiD
- ABI SOLiD
- article
- Tools & Data Sets
- color space (0123) => base space (ACGT)
- .csfsta file : in color space; start with a known base (usually T)
- low error rate (higher accuracy than Illumina)
- 2008: 4G run, read_len=35bp; insert=3Kbp (old)
- 2009: 9G run, read_len=50bp;
- SOLiD™ 3 System generates (Oct 1 2008)
- over 20 gigabases
- mate-paired libraries with insert sizes ranging from 600 bp up to 10 kbp
- human genome for less than $60,000.
- uniform bases quality
- accuracy greater than 99.94%
- because of double base interogation & high cvg, qualities can be "discarded"
Example:
>1_88_1830_R3 G32113123201300232320 >1 _89_1562_R3 G23133131233333101320 ..
Alignment matrix
A C G T A 0 1 2 3 C 1 0 3 2 G 2 3 0 1 T 3 2 1 0
Examples:
AA is encoded as 0 CG is encoded as 3 AACG is encoded as 0 1 3
Features of Color space:
* Color space data are self-complementary
Example:
Base A G C T C G T C G T G C A G
Color space 2 3 2 2 3 1 2 3 1 1 3 1 2
Complemented
Base T C G A G C A G C A C G T C
Color space 2 3 2 2 3 1 2 3 1 1 3 1 2
* Two-Base Encoding and Error Recognition 1 change: measuring error multiple changes starting at a certain point: SNP
Example:
Reference 2 3 2 2 3 1 2 3 1 1 3 1 2
Observed 2 3 2 2 0 1 2 3 1 1 3 1 2
Helicos
Pacific Biosystems
Visigen
Download
From online database
Example:
>gi|45439865|ref|NC_005810.1| Yersinia pestis biovar Microtus str. 91001, complete genome TCGCGCGATCTTTGAGCTAATTAGAGTAAATTAATCCAATCTTTGACCCAAATCTCTGCTGGATCCTCTG GTATTTCATGTTGGATGACGTCAATTTCTAATATTTCACCCAACCGTTGAGCACCTTGTGCGATCAATTG ...
Bioperl scripts:
/fs/sz-user-supported/common/bin/
bp_fetch.pl net::genbank:NC_005810.1 > NC_005810.1 bp_fetch.pl net::genbank:NC_005810 > NC_005810 bp_fetch.pl net::genbank:45439865 > 45439865
Format
Traces
Example: ~/bin/tarchive2amos -o Ba Ba.seq # TA FTP ~/bin/tarchive2amos -o Ba -tracedir traces/ # TA querytrace_db ~/bin/tarchive2amos -o Ba -assembly assembly/ASSEMBLY.xml -tracedir traces/ # AA
Convestion
Example: EMBL->FATSA ~/bin//readseq.sh -f Fasta -o prefix.fasta prefix.embl bp_sreformat.pl -i prefix.embl -o prefix.fasta -if EMBL -of Fasta
Alignments
Whole genomes alignments
- BLAT
- BLASTZ, Post-processing long pairwise alignments article. decom program
- LAGAN
- MUMMER
- AVID