Bumblebee

From Cbcb
Revision as of 17:12, 19 March 2010 by Dpuiu (talk | contribs) (→‎Assembly)
Jump to navigation Jump to search

Data

  • ~ 500B genome
  • Complete mitochondrion genomes:
 NC_011923.1    15468  14.67  Bombus hypocrita sapporoensis mitochondrion, complete genome
 NC_010967.1    16434  13.22  Bombus ignitus mitochondrion, complete genome
 only 88% identity; no rearrangements, only snps, short indels

Traces

  • 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
 Lane   Insert            ReadLen    #Mates       Coverage    Comments
 1      3K(2..6,avg 4K)   124        34,944,099   14X         865,687(1.2%) reads have qual==0
 2      8K(7..9,avg 8K)   124        32,540,640   13X

 3      400               124        34,745,750               # gDNA ; originally thought to be 500bp insert instead of 400
 5      400                          34,601,239
 6      400                          34,553,857
 7      400                          34,682,612
 8      400                          12,975,839
  • Adaptors
 >circularizarion
 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 >circularizarion.revcomp
 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG 
 >5
 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
 >3
 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Tasks to figure out

  1. Erroneous reads/bases, which we need to correct or discard
  2. GC bias, so we can compute a-stats properly
  3. Redundancy in the long paired ends, which are lane 1 and lane 2.
  • Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
    • Some reads will begin in the circularization adaptor and thus will have only one usable read
    • Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
    • Most reads will have at least 36bp from each end before hitting the adaptor.
    • Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)
  • A small but significant number of reads from the 3kb and 8kb libraries are not recircularized.
    • Thus their mate distance is +400bp rather than -3kb or -8kb.
    • It's apparently the result of a faulty batch of cre recombinase. This causes problems with contiging and scaffolding.
    • It is possible to remove these reads by removing
  1. mate pairs where neither read is trimmed (thus no adapter ligation may have occurred)
  2. mate pairs where one read begins with the adapter sequence.
    • We are working on this, up to now our paired assembly stages have been disappointing.
  • Matt's idea is to exclude all mate pair reads that don't have evidence of the linker with flanking useful sequence, as a way to avoid uncircularized molecules that will give misleading "mate pairs" only 400 bp apart.
    • There has been no trimming of the adaptor, which is the 42 base 454 adaptor, so its presence can be used to indicate potentially good mate pairs.
    • Even tossing half the mate pairs might not be a problem, as we have perhaps too many anyway.
    • But you will also need to toss redundant mate pairs, and that will indeed reduce the total a lot.
    • Just to be clear - the 500 base mate pairs should have no such problems, except that as Matt has found from his preliminary assembly, the mean fragment length is actually 400 bp rather than 500 bp (and the 3 and 8 kb PE reads are typically shorter than nominally given, e.g. more like 2.5 and 6 kb).
    • You'll also need to throw out all the reads where one of the mates /starts/ with linker, I assume you'd do that anyway. We're also working on ways round this; one might be when we get a better assembly we'll find some better characteristic to filter the unrecircularized reads on.

Trimming

  • Quality trimming: trim all bases with fastq quality eq "B" (0)
  cat *fastq | ~/bin/fastq2clq.pl 
  • Adaptor trimming: Align all subsets to adaptors
 C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
 5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
 id  len    gc%
 C   42     30.95  
 3   52     55.77  
 5   67     59.70  
 nucmer -l 8 -c 16 -b 32 -g 32 adaptors.seq  ...
 delta-filter -l 16 -q   ...
 cat *.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 ...
  • Median adaptor/primer positions(5-3)
 Lib       adaptorPos     5'pos       3'pos 
 s_1       34-75          0-36        0-19
 s_2       2-40           0-36        0-19
  • Mate stats
 Lib        #mates    adaptor.bothMates   adaptor.noMate   adaptor.oneMate   adaptor.oneMate(filtered)   
 s_1        34944099  269156              9804247          24870696          6048164(17.3%)               
 s_2        32540640  91528               16181288         16267824          1061858( 3.2%)   
 total      67484739                                                         7110022(10.5%)
  • Filtered read clr stats
 Lib        #reads       min    q1     q2     q3     max        mean       n50        sum            
 s_1        12096328     64     80     95     115    124        96.56      101        1,168,064,632     
 s_2        2123716      64     80     96     115    124        96.59      101          205,122,226 
 total      14220044     64     80     95     115    124        96.57      101        1,373,186,858 
  • Filtered read GC% stats
 Lib        #reads       min    q1     q2     q3     max        mean       n50                    
 s_1        12096322     0.00   31.93  36.26  42.35  100.00     37.45      38        
 s_2        2123715      0.00   31.88  36.46  42.48  100.00     37.56      38         
  • Other frequent kmers
 26mer : ACGTTATAACGTATTACGTTATATGG -> revcomp -> CCATATAACGTAATACGTTATAACGT : ~10% of the traces
 10mer : AAAAAAAAAA                               TTTTTTTTTT                 : ~32% of the traces    
 53mer: CGATTTCCATGGCGTCGTTTGAGGATTCCAATACGGCGAACCTGTTGTGAGTG                : ~2% of the mito seqs (either begin or end); not present in the 2 complete mito's (probably ok)
  • Location:
 /fs/szattic-asmg4/Bees/Bombus_impatiens

D Kelly's trimming

 438088072 total reads
 109166398 reads were thrown away
 148886138 reads were corrected and/or trimmed (to a min length of 30 bp)

Assembly

CA.bog

  • Input  : 31*2M s_1 reads trimmed to 100bp & formatted by fastqToCA
  • Spec file
 unitigger =                      bog
 ovlOverlapper =                  mer
 obtMerThreshold =                400
 ovlMerThreshold =                120
 doOverlapTrimming =              0
 
  • Unitigger : max utg len=852bp
  • Consensus after unitigger : 3 out of 129 jobs failed
  • Location
 /scratch1/Bombus_impatiens/Assembly/31M

CA.utg filtered

  • Input: 7*2M s_1 & s_2 reads formatted by convert-fasta-to-v2.pl
  • Filter:
    • only one read from the mate contains the adaptor in the 64..124bp range
    • both reads from the mate have good quality in the 0..64bp range
  • Spec file
 unitigger            =  utg  
 ovlOverlapper        =  ovl  
 obtMerThreshold      =  400
 ovlMerThreshold      =  200
 doOverlapTrimming    =  0     => reads < 64 bp atre trimmed by the gatekeeper; no need to trim
  • Location
 /scratch1/Bombus_impatiens/Assembly/14M.redo