Data
- ~ 500B genome
- Complete mitochondrion genomes:
NC_011923.1 15468 14.67 Bombus hypocrita sapporoensis mitochondrion, complete genome
NC_010967.1 16434 13.22 Bombus ignitus mitochondrion, complete genome
only 88% identity; no rearrangements, only snps, short indels
Traces
- 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
Lane Insert ReadLen #Mates #Reads Coverage Orientation Comments
1 3K(2..6,avg 4K) 124 34,944,099 14X outie 865,687(1.2%) reads have qual==0
2 8K(7..9,avg 8K) 124 32,540,640 13X outie
3 400 124 34,745,750 . gDNA ; originally thought to be 500bp insert instead of 400
5 400 124 34,601,239 .
6 400 124 34,553,857 .
7 400 124 34,682,612 .
8 400 124 12,975,839 .
3-8 151,559,297 303,118,594 75X
1-8 219,044,036 438,088,072 108X
Two new 3kb libraries to come; ~ 70% are true pair ends
>circularizarion
CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
>circularizarion.revcomp
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>5
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
>3
CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[1235678]_[12]_sequence.txt : s_1-8 libs
/fs/szattic-asmg4/Bees/Bombus_impatiens/3kb_Bimpatiens.txt : 88 reads
Tasks to figure out
- Erroneous reads/bases, which we need to correct or discard
- GC bias, so we can compute a-stats properly
- Redundancy in the long paired ends, which are lane 1 and lane 2.
- Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
- Some reads will begin in the circularization adaptor and thus will have only one usable read
- Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
- Most reads will have at least 36bp from each end before hitting the adaptor.
- Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)
- A small but significant number of reads from the 3kb and 8kb libraries are not recircularized.
- Thus their mate distance is +400bp rather than -3kb or -8kb.
- It's apparently the result of a faulty batch of cre recombinase. This causes problems with contiging and scaffolding.
- It is possible to remove these reads by removing
- mate pairs where neither read is trimmed (thus no adapter ligation may have occurred)
- mate pairs where one read begins with the adapter sequence.
- We are working on this, up to now our paired assembly stages have been disappointing.
- Matt's idea is to exclude all mate pair reads that don't have evidence of the linker with flanking useful sequence, as a way to avoid uncircularized molecules that will give misleading "mate pairs" only 400 bp apart.
- There has been no trimming of the adaptor, which is the 42 base 454 adaptor, so its presence can be used to indicate potentially good mate pairs.
- Even tossing half the mate pairs might not be a problem, as we have perhaps too many anyway.
- But you will also need to toss redundant mate pairs, and that will indeed reduce the total a lot.
- Just to be clear - the 500 base mate pairs should have no such problems, except that as Matt has found from his preliminary assembly, the mean fragment length is actually 400 bp rather than 500 bp (and the 3 and 8 kb PE reads are typically shorter than nominally given, e.g. more like 2.5 and 6 kb).
- You'll also need to throw out all the reads where one of the mates /starts/ with linker, I assume you'd do that anyway. We're also working on ways round this; one might be when we get a better assembly we'll find some better characteristic to filter the unrecircularized reads on.
Trimming
- Quality trimming: trim all bases with fastq quality eq "B" (0)
cat *fastq | ~/bin/fastq2clq.pl
- Adaptor trimming: Align all subsets to adaptors
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
id len gc%
C 42 30.95
3 52 55.77
5 67 59.70
nucmer -l 8 -c 16 -b 32 -g 32 adaptors.seq ...
delta-filter -l 16 -q ...
cat *.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 ...
- Adaptor/primers median positions in the reads
Lib adaptorPos 5'primerPos 3'primerPos
s_1 34-75 0-36 0-19
s_2 2-40 0-36 0-19
Lib #mates adaptor.bothMates adaptor.noMate adaptor.oneMate adaptor.oneMate(filtered)
s_1 34944099 269156 9804247 24870696 6048164(17.3%)
s_2 32540640 91528 16181288 16267824 1061858( 3.2%)
total 67484739 7110022(10.5%)
Lib #mates #reads min q1 q2 q3 max mean n50 sum
s_1 6048164 12096328 64 80 95 115 124 96.56 101 1,168,064,632
s_2 1061858 2123716 64 80 96 115 124 96.59 101 205,122,226
total 7110022 14220044 64 80 95 115 124 96.57 101 1,373,186,858
Lib #reads min q1 q2 q3 max mean n50
s_1 12096322 0.00 31.93 36.26 42.35 100.00 37.45 38
s_2 2123715 0.00 31.88 36.46 42.48 100.00 37.56 38
26mer : ACGTTATAACGTATTACGTTATATGG -> revcomp -> CCATATAACGTAATACGTTATAACGT : ~10% of the traces
10mer : AAAAAAAAAA TTTTTTTTTT : ~32% of the traces
53mer: CGATTTCCATGGCGTCGTTTGAGGATTCCAATACGGCGAACCTGTTGTGAGTG : ~2% of the mito seqs (either begin or end); not present in the 2 complete mito's (probably ok)
s_[12] : /nfshomes/dpuiu/bin/fastq2adaptorFreeFrg.amos
s_[35678] : /nfshomes/dpuiu/bin/fastqfrg.amos
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[1235678]_[12]_sequence.txt # original fastq files
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/s_[1235678]_[12]_sequence.cor.txt # corrected fastq files
/fs/szattic-asmg5/Bees/Bombus_impatiens/s_[12]/all/s_[12].64.rev.frg # adaptor free s_[12] mated reads
/fs/szattic-asmg5/Bees/Bombus_impatiens/error_free/frg/s_[1235678].frg # adaptor free & corrected s_[1235678] reads
D Kelly's trimming
. elem min q1 q2 q3 max mean n50 sum
s_1_1_sequence.cor.txt 5436814 30 71 90 115 124 89.70 100 487673256
s_1_2_sequence.cor.txt 5864225 30 77 92 110 124 93.27 98 546956864
s_2_1_sequence.cor.txt 1053858 30 80 96 118 124 97.16 102 102395785
s_2_2_sequence.cor.txt 1041846 30 78 93 110 124 93.51 99 97426679
s_3_1_sequence.cor.txt 33668302 30 105 124 124 124 111.04 124 3738530761
s_3_2_sequence.cor.txt 32554322 30 82 108 124 124 100.42 120 3269039697
s_5_1_sequence.cor.txt 33579744 30 109 124 124 124 111.65 124 3749192427
s_5_2_sequence.cor.txt 32465412 30 84 112 124 124 102.13 124 3315553171
s_6_1_sequence.cor.txt 33535725 30 109 124 124 124 111.60 124 3742602285
s_6_2_sequence.cor.txt 32390877 30 83 109 124 124 100.92 123 3268875471
s_7_1_sequence.cor.txt 33674235 30 112 124 124 124 112.19 124 3777917379
s_7_2_sequence.cor.txt 32518568 30 84 110 124 124 101.60 124 3303807321
s_8_1_sequence.cor.txt 11777821 30 113 124 124 124 112.30 124 1322658923
s_8_2_sequence.cor.txt 12176364 30 84 110 124 124 101.51 124 1236034348
total 301,738,113 . . . . . . . 31958664367
total (64bp+) 275,763,594 . . . . . . . 30693543885
s_1.mates 5320163
s_2.mates 1034086
s_3.mates 31857304
s_5.mates 31820553
s_6.mates 31748713
s_7.mates 31891468
s_8.mates 11168258
total 144,840,545
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/frg/s_?.frg # frg
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/s_?_[12]_sequence.cor.txt # fastq
Assembly
CA.bog s_1
- Input : 31*2M s_1 reads trimmed to 100bp & formatted by fastqToCA
unitigger = bog
ovlOverlapper = mer
obtMerThreshold = 400
ovlMerThreshold = 120
doOverlapTrimming = 0
- Unitigger : max utg len=852bp
- Consensus after unitigger : 3 out of 129 jobs failed
/scratch1/Bombus_impatiens/Assembly/31M
CA.utg s_1,2 filtered
- Input: 7*2M s_1 & s_2 reads formatted by convert-fasta-to-v2.pl
- Filter:
- only one read from the mate contains the adaptor in the 64..124bp range
- both reads from the mate have good quality in the 0..64bp range
unitigger = utg
ovlOverlapper = ovl
obtMerThreshold = 400
ovlMerThreshold = 200
doOverlapTrimming = 0 => reads < 64 bp atre trimmed by the gatekeeper; no need to trim
#ovls/read
reads min q1 q2 q3 max mean n50 sum
14220044 0 1 5 31 514 31.30 131 445090932
. elem min q1 q2 q3 max mean n50 sum
ctg 2 1004 1004 1055 1055 1055 1029.50 1055 2059
deg 1433143 64 115 129 164 1028 145.79 145 208938949
assembled 7557472
singletons 6662572
cat 9-terminator/asm.posmap.frgdeg | sort -nk2 -nk3 | perl ~/bin/posmap2ovl.pl | p 'chop $F[1]; chop $F[2]; print "$F[1] $F[2]\n"; print "$F[2] $F[1]\n";' | count.pl -m 2 | more
/scratch1/Bombus_impatiens/Assembly/14M.redo
SOAPdenovo s_3..8 orig (CBCB)
- Kmer=23
- Input: s_3,5,6,7,8 original reads
- Error correction: no
- Summary
. elem min q1 q2 q3 max mean n50 sum
scf 571,114 100 106 115 141 156066 162.19 137 92,628,126
ctg 54049561 24 24 28 42 2049 35.04 35 1,893,660,606
gapSeq 49518 28 123 143 181 424 152.97 158 7,574,733
scaffold672 156066 35.63
cat asm.scafSeq | ~/bin/scafffasta2scaff.pl | tail -21 | getSummary.pl -i 2 -t ctg
cat asm.scafSeq | ~/bin/scafffasta2scaff.pl | tail -21 | head -20| getSummary.pl -i 3 -t gap
. elem min q1 q2 q3 max mean n50 sum
ctg 21 481 2943 5480 9853 19523 7268.48 12202 152638
gap 20 1 166 183 246 302 171.40 233 3428
SOAPdenovo s_3..8 corr (CBCB)
- Kmer=31
- Input: s_3,5,6,7,8 reads
- Error correction: yes
- Summary
elem min q1 q2 q3 max mean n50 sum
scf 106,217 100 140 434 2418 102317 2,177 7099 23,1261,742
SOAPdenovo s_3..8 corr (Illinois)
- Kmer=31
- Input: s_3,5,6,7,8 reads
- Error correction: yes; UIUC method
- Summary
. elem min q1 q2 q3 max mean n50 sum
scf 17,550 13,460 236,225,169
ctg 4004102 31 97,618 1916 6020 230,333,709
ctg100bp+ 120167 100
SOAPdenovo s_1..8 corr (Illinois)
- Kmer=31
- Input: s_1,2,3,5,6,7,8 reads
- Error correction: yes; CBCB method
- Summary
. elem min q1 q2 q3 max mean n50 sum
ctg200bp+ 43603 201 752 2786 9518 167534 7637.63 19895 333,023,446
ftp://stan.cropsci.uiuc.edu/download/bombus1-k64-contigs.fa.min200
ginkgo:/scratch1/Bombus_impatiens/Assembly/SOAPdenovo.s_1-8.cor.UIUC/
CA s_1..8 corr OBT (CBCB) *
doOverlapTrimming = 1
ovlOverlapper = ovl
unitigger = bog
*BatchSize = 2000000
*BlockSize = 2000000
ovlMemory = 8GB
gatekeeper -dumpfragments asm.gkpStore | grep ^fragmentClear ...
LOAD STATS
7 libInput
7 libLoaded
0 libErrors
301738113 frgInput
301738113 frgLoaded
25974519 frgErrors
144840545 lkgInput
124575590 lkgLoaded
20264955 lkgErrors
0 lkgWarnings
275763594 numRandom
301738113 numNormal
GLOBAL STATS
301738113 FRG
7 LIB
LibraryName numActiveFRG numDeletedFRG numMatedFRG readLength clearLength
GLOBAL 274282535 27455578 247151634 30524746650 29445986650
LegacyUnmatedReads 0 0 0 0 0
s_1 10409320 891719 9039810 996306280 994802849
s_2 2054575 41129 1987728 197829588 197593453
s_3 59894531 6328093 53925476 2382786529 2127257586
s_5 60127274 5917882 54512448 2459696212 2209078913
s_6 59813485 6113117 54062058 2396359740 2152656620
s_7 60278536 5914267 54647258 2476326572 2237423989
s_8 21704814 2249371 18976856 2435572545 2347304056
gatekeeper -dumplibraries -tabular asm.gkpStore
UID IID Orientation Mean StdDev NumFeatures
s_1 1 I 4000 400 1582823088
s_2 2 I 8000 800 1582823088
s_3 3 I 400 40 1582823088
s_5 4 I 400 40 1582823088
s_6 5 I 400 40 1582823088
s_7 6 I 400 40 1582823088
s_8 7 I 400 40 1582823088
meryl -Dh -s 0-mercounts/asm-C-ms22-cm0
Found 23686053415 mers.
Found 265670791 distinct mers.
Found 8682767 unique mers.
...
#freq count %
1 8682767 0.0327 0.0004
2 4288602 0.0488 0.0007
72* 3803015 0.7150 0.3229
73 3797615 0.7293 0.3346
n=((301738113/2000000)+0.5)=151
OBT/OVL jobs = n*n/2 =151*76=11476
~ 20 min/OBT job =~ 0.33 hr/OBT job => 0.33*11476/32=5 days
key sum count mean
CLR 31958664367 301738113 105.915239043733
OBTINITIAL 30779687358 301610679 102.051052900551
OBTMERGE 30052401719 301610679 99.6397137483318
LATEST 30052138325 301610679 99.638840456972
cat asm.repeatmodel.lib.00*stats | egrep '^Lib|nSamples|median' | p 'chomp; if(/Lib/) {print "\n$_"} else { print " $F[1]"}' | pretty -o
Lib 0 5' 199542773 50
Lib 0 3' 199542773 50
Lib 1 5' 6682072 38
Lib 1 3' 6682072 37
Lib 2 5' 1306720 37 ???
Lib 2 3' 1306720 42 ???
Lib 3 5' 43868663 50
Lib 3 3' 43868663 50
Lib 4 5' 43939366 51
Lib 4 3' 43939366 50
Lib 5 5' 43620676 50
Lib 5 3' 43620676 50
Lib 6 5' 43903838 51
Lib 6 3' 43903838 50
Lib 7 5' 16221438 50
Lib 7 3' 16221438 50
- Failures:
- overlapStore: too many files (max 10240) ; fix: recompile the code
- chimera: FAILED file seems to be truncated but contains records from all libs; fix: link asm.chimera.report.FAILED asm.chimera.report
ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor/ # assembly
ginkgo:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor/asm.gkpStore.OBTCHIMERACLR : dumped OBT clear ranges, 0/1 undel/del
CA s_1..8 corr noOBT (CBCB)
doOverlapTrimming = 0
ovlOverlapper = ovl
unitigger = utg
cat asm.repeatmodel.lib.00*stats | egrep '^Lib|nSamples|median' | p 'chomp; if(/Lib/) {print "\n$_"} else { print " $F[1]"}' | pretty -o
Lib 0 5' 212707959 51
Lib 0 3' 212707959 51
Lib 1 5' 7387977 39
Lib 1 3' 7387977 39
Lib 2 5' 1413291 40 ???
Lib 2 3' 1413291 45 ???
Lib 3 5' 46756517 51
Lib 3 3' 46756517 51
Lib 4 5' 46786172 52
Lib 4 3' 46786172 51
Lib 5 5' 46531611 52
Lib 5 3' 46531611 51
Lib 6 5' 46891503 52
Lib 6 3' 46891503 51
Lib 7 5' 16940888 52
Lib 7 3' 16940888 51
walnut:/scratch1/Bombus_impatiens/Assembly/CA.s_1-8.cor.noOBT