Bumblebee
Data
- ~ 500B genome
- Complete mitochondrion genomes:
NC_011923.1 15468 14.67 Bombus hypocrita sapporoensis mitochondrion, complete genome NC_010967.1 16434 13.22 Bombus ignitus mitochondrion, complete genome only 88% identity; no rearrangements, only snps, short indels
Traces
- 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
Lane Insert ReadLen #Mates Coverage Comments 1 3K(2..6,avg 4K) 124 34,944,099 14X 865,687(1.2%) reads have qual==0 2 8K(7..9,avg 8K) 124 32,540,640 13X 3 500(450..600) 124 34,745,750 # gDNA 5 500 34,601,239 6 500 34,553,857 7 500 34,682,612 8 500 12,975,839
- Adaptors
>circularizarion CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA >circularizarion.revcomp TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG >5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG >3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Tasks to figure out
- Erroneous reads/bases, which we need to correct or discard
- GC bias, so we can compute a-stats properly
- Redundancy in the long paired ends, which are lane 1 and lane 2.
- Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
- Some reads will begin in the circularization adaptor and thus will have only one usable read
- Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
- Most reads will have at least 36bp from each end before hitting the adaptor.
- Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)
Trimming
- Keep only the first 100bp (last 24 bp are anyway low qual) otherwise gatekeeper "Seg fault" ? Too much seq discarded
- Quality trimming
cat s_1_*_sequence.*.txt | ~/bin/fastq2clb.pl > s_1_sequence.clb
- Adaptor trimming: Align all subsets to adaptors
>C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA >3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT >5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
id len gc% C 42 30.95 3 52 55.77 5 67 59.70
nucmer -l 8 -c 16 -b 8 -g 8 adaptors.seq s_1_1_sequence.00.seq -p s_1_1_sequence.00 delta-filter -l 16 -q s_1_1_sequence.00.delta > s_1_1_sequence.00.filter-q.delta ... cat s_1_*_sequence.*.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 -minLen 64 > s_1_sequence.clv
Adaptor positions . elem min q1 q2 q3 max mean %elem C.5 25181056 0 2 34 68 108 38 36% C.3 25181056 16 43 75 108 124 75 5.5 374742 0 0 0 0 108 3 0.53% 5.3 374742 17 36 36 67 124 46 3.5 143332 0 0 0 11 108 10 0.20% 3.3 143332 16 18 19 28 124 30
- Stats
. elem <=64 >64 min q1 q2 q3 max mean n50 sum orig 69888198 0 69888198 124 124 124 124 124 124 124 8666136552 clq 69888198 7724022 62164176 0 89 111 124 124 96.76 117 6762346722 clv 69888198 18607136 51281062 0 0 124 124 124 86.96 124 6077231064 clr 69888198 24677952 45210246 0 0 88 115 124 67.31 113 4704368689
- Other frequent kmers
26mer : ACGTTATAACGTATTACGTTATATGG -> revcomp -> CCATATAACGTAATACGTTATAACGT : ~10% of the traces 10mer : AAAAAAAAAA TTTTTTTTTT : ~32% of the traces
- Location:
/fs/szattic-asmg4/Bees/Bombus_impatiens
D Kelly's trimming
438088072 total reads 109166398 reads were thrown away 148886138 reads were corrected and/or trimmed (to a min length of 30 bp)
Assembly
- Trimming
No OBT adaptors in the seqs
- Kmers
meryl -Dh -s 0-mercounts/asm-C-ms22-cm1 >! 22mers.hist Found 3136399464 mers. Found 379123530 distinct mers. Found 201257394 unique mers. Largest mercount is 12006651; 90 mers are too big for histogram.
countKmers.pl most frequent 42mer : CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA ~ 20% of the seqs : circularization adapter
- Overlapper
#overlaps/read reads 0count min q1 q2 q3 max mean n50 sum 62164168 21589472 0 0 4 12 324 11.42 38 709902310
- Unitigger : max utg len=852bp
- Consensus after unitigger : 3 out of 129 jobs failed
- Location
/fs/szdevel/dpuiu/SourceForge/wgs-assembler.030210/Linux-amd64/bin/runCA