Data
- ~ 500B genome
- Complete mitochondrion genomes:
NC_011923.1 15468 14.67 Bombus hypocrita sapporoensis mitochondrion, complete genome
NC_010967.1 16434 13.22 Bombus ignitus mitochondrion, complete genome
only 88% identity; no rearrangements, only snps, short indels
Traces
- 7 pairs of data files (paired ends) : lanes 1..3,5..8 (lane 4 wasn't used)
Lane Insert ReadLen #Mates Coverage Comments
1 3K(2..6,avg 4K) 124 34,944,099 14X 865,687(1.2%) reads have qual==0
2 8K(7..9,avg 8K) 124 32,540,640 13X
3 400 124 34,745,750 # gDNA ; originally thought to be 500bp insert instead of 400
5 400 34,601,239
6 400 34,553,857
7 400 34,682,612
8 400 12,975,839
3-5 138,583,458 69X
>circularizarion
CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
>circularizarion.revcomp
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
>5
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
>3
CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Tasks to figure out
- Erroneous reads/bases, which we need to correct or discard
- GC bias, so we can compute a-stats properly
- Redundancy in the long paired ends, which are lane 1 and lane 2.
- Used the 454 protocol to circularize the DNA for sequencing with the Illumina instrument.
- Some reads will begin in the circularization adaptor and thus will have only one usable read
- Some reads have a few bases of DNA sequence and hit the circularization adaptor right away
- Most reads will have at least 36bp from each end before hitting the adaptor.
- Many reads will not have any adaptor to trim (>125bp of DNA sequence at both ends of the adaptor)
- A small but significant number of reads from the 3kb and 8kb libraries are not recircularized.
- Thus their mate distance is +400bp rather than -3kb or -8kb.
- It's apparently the result of a faulty batch of cre recombinase. This causes problems with contiging and scaffolding.
- It is possible to remove these reads by removing
- mate pairs where neither read is trimmed (thus no adapter ligation may have occurred)
- mate pairs where one read begins with the adapter sequence.
- We are working on this, up to now our paired assembly stages have been disappointing.
- Matt's idea is to exclude all mate pair reads that don't have evidence of the linker with flanking useful sequence, as a way to avoid uncircularized molecules that will give misleading "mate pairs" only 400 bp apart.
- There has been no trimming of the adaptor, which is the 42 base 454 adaptor, so its presence can be used to indicate potentially good mate pairs.
- Even tossing half the mate pairs might not be a problem, as we have perhaps too many anyway.
- But you will also need to toss redundant mate pairs, and that will indeed reduce the total a lot.
- Just to be clear - the 500 base mate pairs should have no such problems, except that as Matt has found from his preliminary assembly, the mean fragment length is actually 400 bp rather than 500 bp (and the 3 and 8 kb PE reads are typically shorter than nominally given, e.g. more like 2.5 and 6 kb).
- You'll also need to throw out all the reads where one of the mates /starts/ with linker, I assume you'd do that anyway. We're also working on ways round this; one might be when we get a better assembly we'll find some better characteristic to filter the unrecircularized reads on.
Trimming
- Quality trimming: trim all bases with fastq quality eq "B" (0)
cat *fastq | ~/bin/fastq2clq.pl
- Adaptor trimming: Align all subsets to adaptors
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
id len gc%
C 42 30.95
3 52 55.77
5 67 59.70
nucmer -l 8 -c 16 -b 32 -g 32 adaptors.seq ...
delta-filter -l 16 -q ...
cat *.filter-q.delta | ~/bin/delta2clr53.pl -5 5,3 ...
- Adaptor/primers median positions in the reads
Lib adaptorPos 5'primerPos 3'primerPos
s_1 34-75 0-36 0-19
s_2 2-40 0-36 0-19
Lib #mates adaptor.bothMates adaptor.noMate adaptor.oneMate adaptor.oneMate(filtered)
s_1 34944099 269156 9804247 24870696 6048164(17.3%)
s_2 32540640 91528 16181288 16267824 1061858( 3.2%)
total 67484739 7110022(10.5%)
Lib #mates #reads min q1 q2 q3 max mean n50 sum
s_1 6048164 12096328 64 80 95 115 124 96.56 101 1,168,064,632
s_2 1061858 2123716 64 80 96 115 124 96.59 101 205,122,226
total 7110022 14220044 64 80 95 115 124 96.57 101 1,373,186,858
Lib #reads min q1 q2 q3 max mean n50
s_1 12096322 0.00 31.93 36.26 42.35 100.00 37.45 38
s_2 2123715 0.00 31.88 36.46 42.48 100.00 37.56 38
26mer : ACGTTATAACGTATTACGTTATATGG -> revcomp -> CCATATAACGTAATACGTTATAACGT : ~10% of the traces
10mer : AAAAAAAAAA TTTTTTTTTT : ~32% of the traces
53mer: CGATTTCCATGGCGTCGTTTGAGGATTCCAATACGGCGAACCTGTTGTGAGTG : ~2% of the mito seqs (either begin or end); not present in the 2 complete mito's (probably ok)
/fs/szattic-asmg4/Bees/Bombus_impatiens/
/fs/szattic-asmg4/Bees/Bombus_impatiens/frg/ # frg files
ginkgo:/scratch1/Bombus_impatiens/Data/
D Kelly's trimming
. elem min q1 q2 q3 max mean n50 sum
s_1_1_sequence.cor.txt 5436814 30 71 90 115 124 89.70 100 487673256
s_1_2_sequence.cor.txt 5864225 30 77 92 110 124 93.27 98 546956864
s_2_1_sequence.cor.txt 1053858 30 80 96 118 124 97.16 102 102395785
s_2_2_sequence.cor.txt 1041846 30 78 93 110 124 93.51 99 97426679
s_3_1_sequence.cor.txt 33668302 30 105 124 124 124 111.04 124 3738530761
s_3_2_sequence.cor.txt 32554322 30 82 108 124 124 100.42 120 3269039697
s_5_1_sequence.cor.txt 33579744 30 109 124 124 124 111.65 124 3749192427
s_5_2_sequence.cor.txt 32465412 30 84 112 124 124 102.13 124 3315553171
s_6_1_sequence.cor.txt 33535725 30 109 124 124 124 111.60 124 3742602285
s_6_2_sequence.cor.txt 32390877 30 83 109 124 124 100.92 123 3268875471
s_7_1_sequence.cor.txt 33674235 30 112 124 124 124 112.19 124 3777917379
s_7_2_sequence.cor.txt 32518568 30 84 110 124 124 101.60 124 3303807321
s_8_1_sequence.cor.txt 11777821 30 113 124 124 124 112.30 124 1322658923
s_8_2_sequence.cor.txt 12176364 30 84 110 124 124 101.51 124 1236034348
total 301738113 . . . . . . . 31958664367
s_1.mates 3152991
s_2.mates 768603
s_3.mates 9633768
s_5.mates 10675551
s_6.mates 9954243
s_7.mates 10262620
s_8.mates 3513074
total 47960850
Assembly
CA.bog
- Input : 31*2M s_1 reads trimmed to 100bp & formatted by fastqToCA
unitigger = bog
ovlOverlapper = mer
obtMerThreshold = 400
ovlMerThreshold = 120
doOverlapTrimming = 0
- Unitigger : max utg len=852bp
- Consensus after unitigger : 3 out of 129 jobs failed
/scratch1/Bombus_impatiens/Assembly/31M
CA.utg filtered
- Input: 7*2M s_1 & s_2 reads formatted by convert-fasta-to-v2.pl
- Filter:
- only one read from the mate contains the adaptor in the 64..124bp range
- both reads from the mate have good quality in the 0..64bp range
unitigger = utg
ovlOverlapper = ovl
obtMerThreshold = 400
ovlMerThreshold = 200
doOverlapTrimming = 0 => reads < 64 bp atre trimmed by the gatekeeper; no need to trim
#ovls/read
reads min q1 q2 q3 max mean n50 sum
14220044 0 1 5 31 514 31.30 131 445090932
. elem min q1 q2 q3 max mean n50 sum
ctg 2 1004 1004 1055 1055 1055 1029.50 1055 2059
deg 1433143 64 115 129 164 1028 145.79 145 208938949
assembled 7557472
singletons 6662572
cat 9-terminator/asm.posmap.frgdeg | sort -nk2 -nk3 | perl ~/bin/posmap2ovl.pl | p 'chop $F[1]; chop $F[2]; print "$F[1] $F[2]\n"; print "$F[2] $F[1]\n";' | count.pl -m 2 | more
/scratch1/Bombus_impatiens/Assembly/14M.redo
