Megachile rotundata

From Cbcb
Revision as of 15:11, 6 September 2010 by Dpuiu (talk | contribs) (Data)
Jump to navigation Jump to search

Data

Original Traces

  • 8 pairs of data files (paired ends)
 cat trace.count | grep _1_ | sed 's/_sequence.txt//' | perl -ane 'print "  ",$F[1],"\t",$F[0]/4,"\t",$F[0]/2,"\n";'
 lib        insert   mates           reads        readLen   ~coverage(500M genome)  reverse  adaptors            comments
 s_2_3kbp   3000     21,563,283      43,126,566   124       11                      ?        circularizarion
 s_2_5kbp   5000/300 36218589        72,437,178   35        5                       yes      ?                   insert size is << 5kbp
 s_2_8kbp   8000     198377          396,754      124       0.1                     ?        ?
 s_3        475      35548153        71,096,306   124       18
 s_4        475      35471044        70,942,088   124       18
 s_5        475      35616846        71,233,692   124       18
 s_6        475      35303840        70,607,680   124       18
 s_7        475      34893313        69,786,626   124       18

Corrected Traces

  • Mated ones
 lib        insert   mates           reads
 s_2_3kb    3000     4,823,235       9,646,470   
 s_2_8kb    8000     111,267         222,534    
 s_3        475      33,024,597      66,049,194  
 s_4        475      33,237,593      66,475,186  
 s_5        475      33,150,790      66,301,580  
 s_6        475      33,223,371      66,446,742  
 s_7        475      32,647,890      65,295,780

Adaptors

 >circularizarion
 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 >circularizarion.revcomp
 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG 

Location

 /fs/szattic-asmg5/Bees/Megachile_rotundata/error_correction/large_libs/s_?_?_?kb.sequence.cor.all.txt
 ftp://ftp.cbcb.umd.edu/pub/data/assembly/Megachile_rotundata/reads/s_?_?_?kb.sequence.cor.all.txt.gz

 /fs/szattic-asmg5/Bees/Megachile_rotundata/frg  # frg files to assemble

Assemblies

  • CA Version: 6.1 (09/01/2010) /fs/szdevel/dpuiu/SourceForge/wgs-6.1/Linux-amd64/bin/runCA
  • SOAP version 1.04: /nfshomes/dpuiu/szdevel/SOAPdenovo_Release1.04/

CA noOBT partial

  • Bog consensus : 4014 error reads in 39 unitigs
 grep FAILED 5-consensus/asm*err | wc -l                                # 4014
 grep FAILED 5-consensus/asm*err | awk '{print $3}' | sort -u | wc -l   # 39


  • Locations
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial.failed
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial


CA noOBT

Gatekeeper

  • ~ 74X cvg
 LOAD                  STATS          
 7                     libInput       
 7                     libLoaded      
 0                     libErrors      
 5                     libWarnings    
 
 326,236,387           frgLoaded        
 326236387             numRandom      
 326236387             numPacked       

 LibraryName           numActiveFRG  numDelFRG  numMatedFRG  readLength   clearLength    #AATCATACAATCACAATCATAC|GTATGATTGTGATTGTATGATT   #AATCATACAATCAC|GTGATTGTATGATT   #AATCATACAATCAC|GTGATTGTATGATT(1mutation)
                                                                                                                                                             
 GLOBAL                326,236,387   0          315518526    37451489553  37418130441  
 LegacyUnmatedReads    0             0          0            0            0            
 s_2_3kb               9107424       0          9107424      942165284    910444046      #1125738  12%                                    1366161
 s_2_8kb               209336        0          209336       21814418     20787384       #46762    22%                                    55736(26%)                          68729(32%)
 s_3                   63618839      0          61696784     7343024554   7342819494     #         11%
 s_4                   63544688      0          61255960     7291557748   7291478152     #6804757  11%
 s_5                   63370860      0          61084368     7271218123   7271051639     #         11%
 s_6                   63780887      0          61685156     7359094156   7359012512     #         11%
 s_7                   62604353      0          60479498     7222615270   7222537214     #         11%

Meryl

 meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 
 Found 30570218845 mers.
 Found 271464470 distinct mers.
 Found 11164787 unique mers.
 Largest mercount is 87984949; 1896 mers are too big for histogram.
 1       11164787        0.0411  0.0004
 2       9376915         0.0757  0.0010
 3       3714582         0.0894  0.0013
 ...
 54      5344148         0.6573  0.1788
 ... 
 fasta2tab.pl 0-mercounts/asm.nmers.ovl.fasta | sort -n -r | head -5
 87,908,217        AATCATACAATCACAATCATAC
 84,450,288        CAATCATACAATCACAATCATA
 ...
 74,975,282        AATAATATGAGTTAGATTGATA
 egrep -c 'AATCATACAATCACAATCATAC|GTATGATTGTGATTGTATGATT' *fastq *txt > egrep.count
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Data/error_free/egrep.count
 meryl -Dh -s 0-mercounts/asm-C-ms15-cm0 | head
 Found 32850820919 mers.
 Found 142500876 distinct mers.
 Found 2381895 unique mers.
 Largest mercount is 125816941; 2023 mers are too big for histogram.
 1       2381895 0.0167  0.0001
 2       2325770 0.0330  0.0002
 3       708786  0.0380  0.0003
 ...
 54      1851586 0.4894  0.0671
...

Overlap

  • job count :
 cat 1-overlapper/ovlopts.pl | grep ^\"h | wc -l
 924
  • Failures: 709 jobs failed; runCA 6.1 could not restart overlap properly !!!
 cat 1-overlap/overlap*out | grep "^Could not" | sort -u
 Could not malloc memory (1305184948 bytes)
 cat 1-overlapper/*pl | grep ^\"0 | sed 's/"//' | sed 's/\",//' >! 1-overlapper/ovlopts.pl.0
 cat 1-overlapper/*pl | grep ^\"h | sed 's/"//' | sed 's/\",//' >! 1-overlapper/ovlopts.pl.h
 cat 1-overlapper/*pl | grep ^\"-h | sed 's/"//' | sed 's/\",//' >! 1-overlapper/ovlopts.pl.-h

 paste 1-overlapper/ovlopts.pl.* | p 'print "overlap -M 8GB --hashload 0.8 -t 1 -h $F[3]  -r $F[5] -k 22 -k  \
       ./0-mercounts/asm.nmers.ovl.fasta  -o ./1-overlapper/$F[0]/$F[1].ovb.gz ./asm.gkpStore > \
       ./1-overlapper/overlap.0$..out \n";' | tail -709 > overlap.sh
  • Stats
 overlapStore -d asm.ovlStore | awk '{print $1}' | uniq -c | awk '{print $1}' | count.pl | getSummary.pl -i 0 -j 1
 overlapStats -G asm.gkpStore -O asm.ovlStore -o asm

Location

 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT

SOAPdenovo (Tanja)

 cat *.ContigIndex | grep -v ^E | grep -v ^i | count.pl -i 1 | getSummary.pl -j 1 -t "contigs"
 cat *.ContigIndex | grep -v ^E | grep -v ^i | count.pl -i 1 | getSummary.pl -j 1 -min 100 -t "contigs(>100bp)"
 grep "^>" *.scaf | getSummary.pl -i 2 -t scaf
  • Stats
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 contigs              9742349    31     32     33     37     114832     60.09      44         585430821      
 contigs(>100bp)      177327     100    131    261    1398   114832     1333.68    3897       236496823     # N50 for Bee was 7K
 scaf                 7863       102    903    3272   17692  2338728    37825.70   240706     297423517     # N50 for Bee was 1.17M

  • Location
 /fs/szattic-asmg5/Bees/Megachile_rotundata/Assembly/assembly5kbForAll

SOAPdenovo (Daniela)

  • Stats
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 contigs(all)         6917796    31     32     34     40     121554     70.46      73         487401812      
 contigs(>100bp)      210666     100    124    222    1174   121554     1108.69    3138       233563401
 scaff                25119      351    1896   4444   10914  1102803    11041.00   26876      277338897
 cat asm.K31.contig | grep "^>" | awk '{print $3}' | uniq -c | awk '{print $2,$1}'  > asm.K31.contigLen.count
  • Location
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/SOAPdenovo-redo