Megachile rotundata

From Cbcb
Jump to navigation Jump to search

Data

Original Traces

  • 8(+2) pairs of data files (paired ends)
 lib        insert   mates           reads        readLen   ~coverage(500M genome)   adaptor
 s_2_3kbp   3000     21,563,283      43,126,566   124       11                       yes
 s_2_5kbp   5000     36,218,589      72,437,178   35        5                        no 
 s_2_8kbp   8000     198,377         396,754      124       0.1                      yes
 s_3        475      35548153        71,096,306   124       18                       no 
 s_4        475      35471044        70,942,088   124       18                         
 s_5        475      35616846        71,233,692   124       18 
 s_6        475      35303840        70,607,680   124       18
 s_7        475      34893313        69,786,626   124       18
 total      .        198,594,856     397,189,712  .         98*
 s_2_1kb    1100     32,634,858      65,269,716   100       13                        no            
 ?          1500
  • Location
 /fs/szattic-asmg5/Bees/Megachile_rotundata/*txt
 /fs/szattic-asmg5/Bees/Megachile_rotundata/newLibrary/*txt
  • Ftp
 ftp.biotec.illinois.edu 
 ftp://username@ftp.biotec.illinois.edu 
 login: generobi
 Password: GRbeehi3

Corrected/Addaptor-free Traces

  • Mated ones
 lib        insert   mates                     reads          repeatReads
 s_2_3kb    3000     4,823,235 (22%orig)       9,646,470      4,349,208  (45%)
 s_2_8kb    8000     111,267   (56%)           222,534        167,246    (75%)
 s_3        475      33,024,597(92%)           66,049,194     35,777,342 (54%)
 s_4        475      33,237,593                66,475,186     
 s_5        475      33,150,790                66,301,580  
 s_6        475      33,223,371                66,446,742  
 s_7        475      32,647,890                65,295,780
 total      .        170,218,743               340,437,486
  • repeatReads:
    • at least one of the mate contains a perfect match of one of the 15 frequent 22mers listed below
    • 32.5%GC in repeatREads vs ~ 35.5%GC in uniqueReads
  • Location
 /fs/szattic-asmg5/Bees/Megachile_rotundata/error_correction/large_libs/s_?_?_?kb.sequence.cor.all.txt   # large insert libs ;  inverted compared to the original (outies => innies)
 /fs/szattic-asmg5/Bees/Megachile_rotundata/error_free/s_?_?_sequence.cor.txt                            # short insert libs  
 /fs/szattic-asmg5/Bees/Megachile_rotundata/frg/                                                         # frg files to assemble

Adaptors

 >circularizarion
 CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 >circularizarion.revcomp
 TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG

Frequent kmers

  • 22mers which seem to appear in tandem
                                                            ~ %reads    
                                                       s_2_3kb s_2_8kb s_[4567]  s_2_1k
                                                       -------------------------
    1  AATCATACAATCACAATCATAC|GTATGATTGTGATTGTATGATT   12.04   20.1    9.99      21.18
    2  CAATCACAATCATACAATCACA|TGTGATTGTATGATTGTGATTG   10.5    17.87   8.3       2.33
    3  AATAATATGAGTTAGATTGATA|TATCAATCTAACTCATATTATT   7.94    11.77   21.47     9.12
    4  AGTAATTGTCGTTCTATCGATC|GATCGATAGAACGACAATTACT   5.08    7.47    13.04     6.33
    5  ATATAAGCATAATATGGCTAAT|ATTAGCCATATTATGCTTATAT   5.01    7.55    15.15     4.19
    6  CACACAATCACACAATCACACA|TGTGTGATTGTGTGATTGTGTG   4.72    8.57    2.32
    7  ATTACTCTTATTATTATCAATC|GATTGATAATAATAAGAGTAAT   4.62    6.67    11.8
    8  TCACACAATCACAATCACACAA|TTGTGTGATTGTGATTGTGTGA   3.76    7.01    1.54
    9  ACAATTACTATACTTATTACTC|GAGTAATAAGTATAGTAATTGT   2.94    4.39    8.46
   10  AGACAGAGACAGAGACAGAGAC|GTCTCTGTCTCTGTCTCTGTCT   2.17    5.66    1.03      1.03
   11  CACAATCACGATCACACAATCA|TGATTGTGTGATCGTGATTGTG   1.43    2.25    0.5
   12  CTGTCTCTGTCTGTCTCTGTCT|AGACAGAGACAGACAGAGACAG   1.34    3.77    0.68
   13  CAGCGGATATGTGCGAATTAGA|TCTAATTCGCACATATCCGCTG   0.8     0.54    0.73
   14  CTGAGCACAATTCAACACCACA|TGTGGTGTTGAATTGTGCTCAG   0.58    0.35    0.68
   15  AACCTAACCTAACCTAACCTAA|TTAGGTTAGGTTAGGTTAGGTT   0.06    0.15    0.03
   total                                               31      55      50        52
  • Location
 ginkgo:/scratch1/dpuiu/Megachile_rotundata/Data/error_free/noRepeats/         # repeat free FASTQ reads & FRG files
 /fs/szattic-asmg5/Bees/Megachile_rotundata/repeats/                           # repeat ids

Assemblies

  • CA Version: 6.1 (09/01/2010) /fs/szdevel/dpuiu/SourceForge/wgs-6.1/Linux-amd64/bin/runCA
  • SOAP version 1.04: /nfshomes/dpuiu/szdevel/SOAPdenovo_Release1.04/

CA noOBT ; partial s_2_3kb, s_2_8kb, s_3

  • Data : 3 libs : ~ 16X cvg
  • Files
 /fs/szattic-asmg5/Bees/Megachile_rotundata/Assembly/assemblyAdaptorFree/longLibrariesAdaptorFree/s_2_?kb_?.filter.fastq   # inverted compared to the original
 /fs/szattic-asmg5/Bees/Megachile_rotundata/error_free_better/s_3_?_sequence.cor.txt

Gatekeeper

 LibraryName           numActiveFRG    numDeletedFRG  numMatedFRG  readLength  clearLength  
 GLOBAL                72,995,448      0              70632632     8307194830  8278360381   
 LegacyUnmatedReads    0               0              0            0           0            
 s_2_3kb               9,166,343       0              8736228      942501164   914798596    
 s_2_8kb               210,266         0              199620       21669112    20742291     
 s_3                   63,618,839      0              61696784     7343024554  7342819494
 UID             IID     mateUID         mateIID libUID  libIID  isDel   isNonRandom     Orient  Length  clrBeginLATEST  clrEndLATEST
 110000000001    1       120000000001    2       s_2_3kb 1       0       0               I       75      0               75
 120000000001    2       110000000001    1       s_2_3kb 1       0       0               I       123     0               123
 110000000003    3       120000000003    4       s_2_3kb 1       0       0               I       90      0               90
 120000000003    4       110000000003    3       s_2_3kb 1       0       0               I       123     40              123
 ...
 110009166343    9166343 0               0       s_2_3kb 1       0       0               U       76      11              76

 210009166344    9166344 220009166344    9166345 s_2_8kb 2       0       0               I       123     21              123
 ...
 210009376609    9376609 0               0       s_2_8kb 2       0       0               U       88      0               88

 320009376610    9376610 0               0       s_3     3       0       0               U       72      0               72
 ...
 310072995448    72995448 0              0       s_3     3       0       0               U       68      0               68

BOG/ tigStore

  • Number of tigs in the store
 tigStore -g asm.gkpStore -t asm.tigStore 2 -D unitiglist | tail -1 | awk '{print $1}'               # 36318422
  • Single read tigs
 tigStore -g asm.gkpStore -t asm.tigStore 2 -U -d layout | grep -c '^data.num_frags            1$'   # 34985292
 ts2lay | grep -B 9 -A 3 '^data.num_frags            1$'

Stats

 .                  elem       min    q1     q2     q3     max        mean       n50        sum             #repeats    comments          
 scf                20,827     122    3228   6374   13700  202495*    11508      20462*     239696810                   SOAPdenovo: max=1102803 , N50=26876  
 ctg                37,494     65     2185   3998   7706   191323*    6380       10151*     239226293       206         SOAPdenovo: max=121554  , N50=3138
 deg                1,136,469  64     123    143    184    5031       160        164        181954480       807132
 utg                1,437,146  64     123    143    195    67048      308        870        443759899      

 readsTotal         72,995,448
 readsInContigs     27,837,956
 readsInDegenerates  9,627,122
 singletons         34,881,692 (47%)                                                             

 readsWithOuttieMate 3,028,956(4.15%) ???
 Placed reads
 .          badLong  badOuttie   badSame  bothDegen  bothSurrogate  diffScaffold  good      notMated  oneChaff  oneDegen  oneSurrogate  
 s_2_3kb    534      2,998,286   458      1614846    9892           21872         27308     267328    979980    760044    65268         
 s_2_8kb    4        26,864      10       38636      114            294           178       5044      35465     7848      1022          
 s_3        11072    3,806       1104     2369982    61236          53370         23058022  1208112   3967689   371538    87260
 Chaff reads
 .          bothChaff    notMated   oneChaff  
 s_2_3kb    1,277,760    162,787    979,980    
 s_2_8kb    53,588       5,602      35,465     
 s_3        27,684,878   713,943    3,967,689

Issues

  • reads are renamed : HWI-EAS385_0062:2:1:1036:15608#GCCAAT/1 => UID:110000000001 => IID:1
  • reads < 64bp are deleted from the beginning : ID mapping ???
  • lib s_2 orientation ??? Too many badOuttie's

Location

 ginkgo:/scratch1/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial.1/

CA noOBT ; partial : s_2_3kb, s_2_8kb, s_3 ; no repeats

  • Reads that contain at least one of the 15 most frequent 22mers are deleted from the input set

Gatekeeper

 LibraryName           numActiveFRG  numDeletedFRG  numMatedFRG  readLength  clearLength  
 GLOBAL                33811292      0              32385550     3781368484  3772837304   
 LegacyUnmatedReads    0             0              0            0           0            
 s_2_3kb               5103461       0              4928188      518415011   510187775    
 s_2_8kb               53215         0              51436        5395700     5289866      
 s_3                   28654616      0              27405926     3257557773  3257359663   

Overlapper

  • Dirty 3' ends for the s_2_* reads
               totalOvl  avgOvl
 s_2_3kb  5'  4955294   9   
 s_2_3kb  3'  4955294   7   
 s_2_8kb  5'  51050     10  
 s_2_8kb  3'  51050     7   
 s_3      5'  27721948  9   
 s_3      3'  27721948  9   

Bog

 cat 4-unitigger/asm.cga.0 | head
 Global Arrival Rate: 0.125220
 There were 1,983,199 unitigs generated.
 Unitig Length
 65407 -  67872:       4 
 50209 -  58608:       5 
 40073 -  49263:      27 
 30132 -  39913:      72 
 20030 -  29892:     319 
 10001 -  19992:    1979 
  9007 -   9999:     673 
  8000 -   8999:     934 
  7000 -   7999:    1332 
  6000 -   6998:    2048 
  5000 -   5999:    3103 
  4000 -   4999:    4898 
  3000 -   3999:    8120 
  2000 -   2999:   14634 
  1000 -   1999:   26621 
   900 -    999:    4116 
   800 -    899:    4457 
   700 -    799:    5042 
   600 -    699:    6146 
   500 -    599:    8107 
   400 -    499:   11901 
   300 -    399:   19373 
   200 -    299:   64394 
   100 -    199: 1173219 
    90 -     99:  161987 
    80 -     89:  189874 
    70 -     79:  132943 
    64 -     69:   82098

Stats

  • Larger max scf & ctg  !!! (compared with "CA noOBT partial" that assembled the repeats as well)
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 scf                  21041      65     3174   6334   13482  337719*    11376      20153*     239366537      
 ctg                  37668      65     2181   3963   7687   191376*    6343       10083*     238928665      
 deg                  380596     64     107    126    170    4688       163        160        62151395       
 utg                  652051     64     115    133    225    67870      491        2469       320381694    

 readsTotal           33,811,292
 readsInContigs       27,753,101 (82.08%)
 readsInDegenerates   4,004,853  (11.84%)
 singletons           1,276,811  (3.78%)
 Placed reads
 .    badLong  badOuttie  badSame  bothDegen  bothSurrogate  diffScaffold  good      notMated  oneChaff  oneDegen  oneSurrogate  
 1    582      2992742    410      773006     13486          20146         26870     159957    107838    753916    78412         
 2    1228     2          9486     84         124            62            1550      12940     7750      860       
 3    11354    3884       1074     2266364    90824          56066         23001316  1165421   346169    416116    156218        
 Chaff reads
 .    bothChaff  notMated  oneChaff  
 1    52942      15316     107838    
 2    5932       229       12940     
 3    652176     83269     346169
 ~/bin/asm2mdi.pl < asm.asm
 s_2_3kb 16      87  ???
 s_2_8kb 8000    800
 s_3     337     27

Location

 ginkgo:/scratch1/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial.1.noRepeats/


CA noOBT ; partial : s_2_3kb, s_2_8kb, s_3 ; no repeats; reverse

  • Reads that contain at least one of the 15 most frequent 22mers are deleted from the input set
  • s_2_3kb & s_2_8kb libraries were reversed (since most of the reads in "CA noOBT partial" were outies)
  • fewer bad mates

Stats

  • Smaller contigs & scaffolds
.                    elem       min    q1     q2     q3     max        mean       n50        sum            
scf                  29078      85     2860   5164   10207  181627     8479       13424      246567642      
ctg                  44656      65     2101   3536   6391   170614     5341       7911       238550199      
deg                  406759     64     106    126    171    4458       165        163        67471557       
utg                  655784     64     117    135    239    66933      489        2150       320802728      
Placed reads
.    badLong  badOuttie  badSame  bothDegen  bothSurrogate  diffScaffold  good        notMated  oneChaff  oneDegen  oneSurrogate  
1    57,124   476        82       877704     20914          7462          2,743,468   159970    151292    739534    125438        
2    424      10         2        11684      278            94            25,478      1554      2251      6878      1224          
3    26,190   3024       588      2740326    173426         39700         22,393,204  1165407   353861    455848    162918        
Chaff reads
.    bothChaff  notMated  oneChaff  
1    53402      15303     151292    
2    860        225       2251      
3    652368     83283     353861
~/bin/asm2mdi.pl < asm.asm
s_2_3kb 410     94
s_2_8kb 406     63
s_3     337     27

Location

 ginkgo: /scratch1/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial.1.rev.noRepeats

CA OBT ; partial : s_2_3kb, s_2_8kb, s_3 ; no repeats ; doDeduplication

  • smaller contigs, scaffolds

Gatekeeper

 LibraryName           numActiveFRG  numDeletedFRG  numMatedFRG  readLength  clearLength  
 GLOBAL                32121482      1689810        29520314     3627930463  3570353114   
 LegacyUnmatedReads    0             0              0            0           0            
 s_2_3kb               4600173       503288         4034304      473853527   454981975    
 s_2_8kb               47210         6005           41150        4851578     4628382      
 s_3                   27474099      1180517        25444860     3149225358  3110742757   

Stats

 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 scf                  29488      70     2345   4369   8750   202300     7468.57    12354      220233106      
 ctg                  60146      64     1480   2472   4394   77615      3645.31    5339       219251091      
 deg                  294445     54     116    135    205    7625       200.63     218        59074721       
 utg                  504418     52     121    150    320    63670      577.73     2333       291418460

Location

 ginkgo: /scratch1/dpuiu/Megachile_rotundata/Assembly/wgs-OBT-partial.1.noRepeats.noDuplicates

CA noOBT ; partial s_3 , s_4 ; no repeats **

  • Reads that contain at least one of the 15 most frequent 22mers are deleted from the input set

Gatekeeper

 LibraryName           numActiveFRG  numDeletedFRG  numMatedFRG  readLength  clearLength  
 GLOBAL                56839966      0              54032986     6425669702  6425397526   
 LegacyUnmatedReads    0             0              0            0           0            
 s_3                   28654616      0              27405926     3257557773  3257359663   
 s_4                   28185350      0              26627060     3168111929  3168037863

Stats

 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 scf                  12908      148    4003   8811   22202  511831**   19416      42207**    250623581      
 ctg                  23116      64     2888   5959   13088  255301**   10828      20109**    250302752      
 deg                  274961     64     124    139    182    4652       172        164        47499725       
 utg                  574873     64     123    132    202    128547     563        4478       324059992

Location

 ginkgo:/scratch1/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT-partial.2.noRepeats


CA noOBT ; partial s_3 , s_4 , s_5 ; no repeats

  • Reads that contain at least one of the 15 most frequent 22mers are deleted from the input set
 LibraryName           numActiveFRG   numDeletedFRG  numMatedFRG  readLength  clearLength  
 GLOBAL                84767527       0              80416796     9564910726  9564478395   
 LegacyUnmatedReads    0              0              0            0           0            
 s_3                   28654616       0              27405926     3257557773  3257359663   
 s_4                   28185350       0              26627060     3168111929  3168037863   
 s_5                   27927561       0              26383810     3139241024  3139080869

CA noOBT

  • Data : 7 libs : ~ 74X cvg

Gatekeeper

 LibraryName           numActiveFRG  numDelFRG  numMatedFRG  readLength   clearLength    #repeats                                                                                                                                                              
 GLOBAL                326,236,387   0          315518526    37451489553  37418130441  
 LegacyUnmatedReads    0             0          0            0            0            
 s_2_3kb               9107424       0          9107424      942165284    910444046      #
 s_2_8kb               209336        0          209336       21814418     20787384       #
 s_3                   63618839      0          61696784     7343024554   7342819494     #
 s_4                   63544688      0          61255960     7291557748   7291478152     #
 s_5                   63370860      0          61084368     7271218123   7271051639     #
 s_6                   63780887      0          61685156     7359094156   7359012512     #
 s_7                   62604353      0          60479498     7222615270   7222537214     #

Meryl

 meryl -Dh -s 0-mercounts/asm-C-ms22-cm0 
 Found 30570218845 mers.
 Found 271464470 distinct mers.
 Found 11164787 unique mers.
 Largest mercount is 87984949; 1896 mers are too big for histogram.
 1       11164787        0.0411  0.0004
 2       9376915         0.0757  0.0010
 3       3714582         0.0894  0.0013
 ...
 54      5344148         0.6573  0.1788
 ... 
 fasta2tab.pl 0-mercounts/asm.nmers.ovl.fasta | sort -n -r | head -5
 87,908,217        AATCATACAATCACAATCATAC
 84,450,288        CAATCATACAATCACAATCATA
 ...
 74,975,282        AATAATATGAGTTAGATTGATA
 egrep -c 'AATCATACAATCACAATCATAC|GTATGATTGTGATTGTATGATT' *fastq *txt > egrep.count
 mulberry:/scratch2/dpuiu/Megachile_rotundata/Data/error_free/egrep.count
 meryl -Dh -s 0-mercounts/asm-C-ms15-cm0 | head
 Found 32850820919 mers.
 Found 142500876 distinct mers.
 Found 2381895 unique mers.
 Largest mercount is 125816941; 2023 mers are too big for histogram.
 1       2381895 0.0167  0.0001
 2       2325770 0.0330  0.0002
 3       708786  0.0380  0.0003
 ...
 54      1851586 0.4894  0.0671
...

Overlap

  • job count :
 cat 1-overlapper/ovlopts.pl | grep ^\"h | wc -l
 924
  • Failures: 709 jobs failed; runCA 6.1 could not restart overlap properly !!!
 cat 1-overlap/overlap*out | grep "^Could not" | sort -u
 Could not malloc memory (1305184948 bytes)

Bog

 cat 4-unitigger/asm.cga.0
 Global Arrival Rate: 0.443659
 There were 158,805,551 unitigs generated.
 Unitig Length
Global Arrival Rate: 0.443659
100071 - 168549:        21 
 90845 -  99102:        15 
 80566 -  88867:        17 
 70006 -  79485:        39 
 60191 -  69891:        51 
 50210 -  59643:        98 
 40106 -  49917:       191 
 30015 -  39986:       448 
 20006 -  29992:      1068 
 10000 -  19995:      4187 
  9001 -   9999:       942 
  8001 -   8998:      1202 
  7000 -   7999:      1489 
  6000 -   6999:      1927 
  5000 -   5999:      2379 
  4000 -   4999:      3266 
  3000 -   3999:      4580 
  2000 -   2999:      6979 
  1000 -   1999:      9654 
   900 -    999:      1176 
   800 -    899:      1346 
   700 -    799:      1658 
   600 -    699:      2405 
   500 -    599:      4742 
   400 -    499:     13047 
   300 -    399:     26578 
   200 -    299:    361389 
   100 -    199: 135260255 
    90 -     99:   7874207 
    80 -     89:   7147630 
    70 -     79:   5128367 
    63 -     69:   2427507
 138,219,089 out of 158,805,551 contain one of the frequent kmers

CGW

  • Monitor cgw
 ps -C cgw
 PID  PPID %MEM   RSZ %CPU STIME     TIME CMD
  8563  8560 95.2 251872528 88.2 13:24 01:47:56 /fs/szdevel/dpuiu/SourceForge/wgs-6.1/Linux-amd64/bin/cgw  ...
 top -b -p 8563 -d 10 | grep dpuiu > cgw.resource_usage.log
  • Failure 1:
 tail 7-0-CGW/cgw.out 
 ...
 Processed 158,288,858 unitigs with 326,296,236 fragments    #Bumble bee : Processed 61,930,044 unitigs with 301,738,113 fragments
 * Loaded dist s_2_3kb,1 (3000 +/- 300)
 * Loaded dist s_2_8kb,2 (8000 +/- 800)
 * Loaded dist s_3,3 (475 +/- 47.5)
 ...
 * Splitting chimeric input unitigs
 LIB 1 mu = 15.318100 sigma = 89.035478
 LIB 2 mu = 8000.000000 sigma = 800.000000
 LIB 3 mu = 337.817628 sigma = 26.699549
 ...
 minLength = 460
 minSplit  = -429
 Splitting unitig 47689 into as many as 3 unitigs at intervals:  22905,22906
 ..
 Splitting unitig 158234882 into as many as 3 unitigs at intervals: 124,136
 * BuildGraphEdgesDirectly
 Fix (partial): 
 add "-I" flag to cgw in runCA
 cat 7-0-CGW/cgw.out
 ...
 *** BuildGraphEdgesDirectly Operated on 171664374 fragments
  • Failure 2:
 tail 7-0-CGW/cgw.out
 **** Calling CheckEdgesAgainstOverlapper ****
 **** Survived CheckEdgesAgainstOverlapper with 0 failures****
 * Allocating Contig Graph with 158289029 nodes and 14055921 edges
 Could not calloc memory (25326244640 * 1 bytes = 25326244640)
 cgw: AS_UTL_alloc.C:55: void* safe_calloc(size_t, size_t): Assertion `p != __null' failed.

Location

 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/wgs-noOBT

SOAPdenovo (Tanja)

 cat *.ContigIndex | grep -v ^E | grep -v ^i | count.pl -i 1 | getSummary.pl -j 1 -t "contigs"
 cat *.ContigIndex | grep -v ^E | grep -v ^i | count.pl -i 1 | getSummary.pl -j 1 -min 100 -t "contigs(>100bp)"
 grep "^>" *.scaf | getSummary.pl -i 2 -t scaf
  • Stats
 .                    elem       min    q1     q2     q3     max        mean       n50        sum            
 contigs              9742349    31     32     33     37     114832     60         44         585430821      
 contigs(>100bp)      177327     100    131    261    1398   114832     1333       3897       236496823     # N50 for Bee was 7K
 scaf                 7863       102    903    3272   17692  2338728    37825      240706     297423517     # N50 for Bee was 1.17M

  • Location
 /fs/szattic-asmg5/Bees/Megachile_rotundata/Assembly/assembly5kbForAll

SOAPdenovo (Daniela)

Stats

 cat asm.K31.contig | grep "^>" | awk '{print $3}' | uniq -c | awk '{print $2,$1}'  > asm.K31.contigLen.count
 .                    elem       min    q1     q2     q3     max          mean       n50        sum            
 scaff                25,119     351    1896   4444   10914  1,102,803    11041      26876      277,338,897
 contigs(all)         6,917,796  31     32     34     40     121,554      70         73         487,401,812      
 contigs(>100bp)      210,666    100    124    222    1174   121,554*     1108       3138*      233,563,401
 reads                340,437,486
 readsOnContigs       171,212,613 

Alignments

  • Align reads to the scaffolds
 soap2-index asm.K31.scafSeq
 mkdir soap2-index
 mv asm.K31.scafSeq.index.* soap2-index/
   
 soap2 -D ... -a s_2_1_3kb_sequence.txt -b s_2_2_3kb_sequence.txt -l 32 -p 16 -v 2 -m 2000 -x 4000  -o s_2_3kb.mated.soap2 -2 s_2_3kb.single.soap2 -R 
 soap2 -D ... -a s_2_1_5kb_sequence.txt -b s_2_2_5kb_sequence.txt -l 32 -p 16 -v 2 -m 4000 -x 6000  -o s_2_5kb.mated.soap2 -2 s_2_5kb.single.soap2 -R 
 soap2 -D ..  -a s_2_1_8kb_sequence.txt -b s_2_2_8kb_sequence.txt -l 32 -p 16 -v 2 -m 6000 -x 10000 -o s_2_8kb.mated.soap2 -2 s_2_8kb.single.soap2 -R
 soap2 -D ..  -a s_3_1_sequence.txt     -b s_3_2_sequence.txt     -l 32 -p 16 -v 2 -m 200 -x  400   -o s_3.mated.soap2     -2 s_3.single.soap2 
 ...
                   mates           mated       single      single.diffScaff        single.sameScaff
 s_2_1kb           32,634,858      1,466,112   8,014,900   131,084                 585,668 
 s_2_3kb           21,563,283      1,545,114   8,449,321   341,974                 1,203,570
 s_2_5kb           36,218,589      5,639,332   44,533,553  4,784,348               30,621,038
 s_2_8kb           198,377         1,068       32,280      1,168                   2,842
 s_3               35,548,153      15,521,020  4,589,276   37,564                  651,924
 
 s_2_3kb.filter    4,823,235       3,730       3,618,426   38,562                  3,017,172
 s_2_8kb.filter    111,267         20          33,819      372                     27,300  
 lib               mates           mated%      single%     single.diffScaff%       single.sameScaff%  
 s_2_1kb           32,634,858
 s_2_3kb           21,563,283      3.58        19.59       0.79                    2.79               
 s_2_5kb           36,218,589      7.785       61.475      6.6                     42.27              
 s_2_8kb           198,377         0.265       8.135       0.29                    0.715              
 s_3               35548153        21.83       6.455       0.05                    0.915
 
 s_2_3kb.filter    4,823,235       0.035       37.51       0.395                   31.275             
 s_2_8kb.filter    111,267         0.005       15.195      0.165                   12.265             
 
  • ReAlign reads to the scaffolds using an incorrect insert size
 soap2 -D ... -a s_2_1_3kb_sequence.txt -b s_2_2_3kb_sequence.txt -l 32 -p 16 -v 2 -m 200 -x 600  -o s_2_3kb.mated.soap2 -2 s_2_3kb.single.soap2  
 soap2 -D ... -a s_2_1_5kb_sequence.txt -b s_2_2_5kb_sequence.txt -l 32 -p 16 -v 2 -m 200 -x 600  -o s_2_5kb.mated.soap2 -2 s_2_5kb.single.soap2  
 soap2 -D ..  -a s_2_1_8kb_sequence.txt -b s_2_2_8kb_sequence.txt -l 32 -p 16 -v 2 -m 200 -x 600  -o s_2_8kb.mated.soap2 -2 s_2_8kb.single.soap2

Location

 mulberry:/scratch2/dpuiu/Megachile_rotundata/Assembly/SOAPdenovo/

SOAPdenovo ; partial : s_[34567] ; no repeats

  • Slightly better results than we got when the s_2_?kb libs were used

Stats

. elem min q1 q2 q3 max mean n50 sum

  scf               24602      333    1724   4380   11049  1,103,462*  11135      27887      273963709
  contigs(all)      2515516    31     33     36     52     148,198     131        1880       330512911      
  contigs(100bp+)   184395     100    127    235    1316   148,198*    1263       3730*      232932308

Location

ginkgo: /scratch1/dpuiu/Megachile_rotundata/Assembly/SOAPdenovo-partial.3.noRepeats/