Kalanchoe
Jump to navigation
Jump to search
Data
- 300M genome
- ~5x 454 from a variety of library sizes
- ~20x illumina (Illumina scale qualities).
- Location:
/fs/szattic-asmg7/Kalenchoe_genome/
454
- Read stats
LIB reads mates meaIns stdIns 20mers ids fff01.frg.gz 545792 0 AT GLMTKIY01 fff02.frg.gz 459461 0 AT GLMTKIY02 fff03.frg.gz 477691 0 AC GLZRKVN01 fff04.frg.gz 610848 0 AAACCCTAAACCCTAAACCCTA GKFZ9MZ01 fff05.frg.gz 450912 0 AAAACCCATAAAGTTGTTATTT GKFZ9MZ02 fff06.frg.gz 548462 0 AACAAGGCACACAGGGGATAGG GKH094001
fff11.frg.gz 418299 118317 20k,17072 4268 CG GMF8K3302 fff12.frg.gz 807808 273276 8k,6609 1652 AT GK7ZAL002 fff13.frg.gz 638072 205830 8k,6571 1642 ACGTACGTACGTACGTACGTAC GLC77YN02 fff14.frg.gz 771593 231598 3k,2749 687 AT GK7ZAL001 fff15.frg.gz 634113 165697 3k,2768 692 AT GLC77YN01
- linker issues
'titanium' == TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG and CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
Illumina
Assembly
Blogs
assemble the illumina lane with SOAPdenovo and then assemble with newbler the 454 lanes and the resulting contig of SOAP2. SOAP uses a de bruijn graph data structure that is well suited for short illumina reads but it is not enough flexible in order to handle 454 reads. Newbler, instead, is based on Overlap Layout Approach that work well with long reads
- CABOG ... throws a lot of errors on our architecture for some reason
- Location:
ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/ ftp://ftp.cbcb.umd.edu/pub/data/assembly/Kalenchoe/README