Dpuiu Assemblathon: Difference between revisions

From Cbcb
Jump to navigation Jump to search
Line 45: Line 45:
== Bacterium, Staph aureus USA300 ==
== Bacterium, Staph aureus USA300 ==


<pre>
* Complete genome        : NC_010079      2872915bp Staphylococcus aureus subsp. aureus USA300_TCH1516
* Complete genome        : NC_010079      2872915bp Staphylococcus aureus subsp. aureus USA300_TCH1516
* In progress genome    : NZ_AASB00000000 2810505bp Staphylococcus aureus subsp. aureus USA300_TCH959, 256 contigs
* In progress genome    : NZ_AASB00000000 2810505bp Staphylococcus aureus subsp. aureus USA300_TCH959, 256 contigs
Line 50: Line 51:
* 454 FLX                : Staphylococcus aureus subsp. aureus USA300_TCH959 HMP0023  http://www.ncbi.nlm.nih.gov/sra/SRX002327?report=full  
* 454 FLX                : Staphylococcus aureus subsp. aureus USA300_TCH959 HMP0023  http://www.ncbi.nlm.nih.gov/sra/SRX002327?report=full  
* Illumina 101bp paired  : Staphylococcus aureus subsp. aureus USA300_TCH1516        http://www.ncbi.nlm.nih.gov/sra/SRX007714?report=full
* Illumina 101bp paired  : Staphylococcus aureus subsp. aureus USA300_TCH1516        http://www.ncbi.nlm.nih.gov/sra/SRX007714?report=full
</pre>


== Human, a single chromosome, medium-sized. ==
== Human, a single chromosome, medium-sized. ==

Revision as of 20:25, 15 December 2010

Links

Assemblers

* CA             /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/Linux-amd64/bin/runCA 
* Newbler
* Velvet
* SOAPdenovo
* Maq

CBCB genomes

  • a bacterial genome. Instead of E. coli, we can use S. aureus USA300, which has sequence data in SRA from 454 and Illumina, paired and unpaired. Daniela has already assemblied it using CA, Newbler, Velvet, SOAPdenovo, and Maq (using its comparative assembly mode, where it aligns to a reference).
  • A medium-sized eukaryote. I'd like to use the Argentine ant or the Bombus impatiens bee - I've just written to Gene Robinson to ask about the bee.
  • Another eukaryote, ideally a larger one. Human would be great, but we just don't have enough time to do multiple human assemblies. So maybe another insect, or perhaps a plant if we can find one for which data is available.

If we can agree on the data sets, then the next step would be to design the experiment - decide in advance which assemblers to run and how many ways to try each one. I'm thinking we should also trim all the data with Quake.

Argentine ant

Bee, Bombus impatiens

Data

  • 497,318,144 Illumina 124bp reads
  • 8 libraries; inserts:
    • 400bp
    • 3k (outie)
    • 8k (outie)
  • Traces

Adapters: in 3k & 8k libraries

C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

Location:

/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt                             # original fastq files

/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[129]_[012]_sequence.cor.rev.txt        # adaptor free corrected reads (long inserts)
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt          # corrected reads (short inserts)

Bacterium, Staph aureus USA300

* Complete genome        : NC_010079       2872915bp Staphylococcus aureus subsp. aureus USA300_TCH1516
* In progress genome     : NZ_AASB00000000 2810505bp Staphylococcus aureus subsp. aureus USA300_TCH959, 256 contigs

* 454 FLX                : Staphylococcus aureus subsp. aureus USA300_TCH959 HMP0023  http://www.ncbi.nlm.nih.gov/sra/SRX002327?report=full 
* Illumina 101bp paired  : Staphylococcus aureus subsp. aureus USA300_TCH1516         http://www.ncbi.nlm.nih.gov/sra/SRX007714?report=full

Human, a single chromosome, medium-sized.