Trace formatting: Difference between revisions
Jump to navigation
Jump to search
| Line 5: | Line 5: | ||
Anomalies: | Anomalies: | ||
* homopolymer lengths can be shorter than real | * homopolymer lengths can be shorter than real | ||
* substitutions less likely than in traditional | * substitutions less likely than in traditional methodssingle base insertions | ||
* carry forward events usually near but not adjacent to homopolymers | |||
GS20 | GS20 | ||
| Line 18: | Line 19: | ||
* 99.5% accuracy rate in unassembled sequences | * 99.5% accuracy rate in unassembled sequences | ||
* identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better => better quality than Sanger sequencing | * identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better => better quality than Sanger sequencing | ||
* The error rate, defined as the number of errors (miscalled bases plus inserted and deleted bases) divided by the total number of expected bases, was 0.49% | |||
* 36% insertions, 27% delitions, 21% N's, 16% substitutions | |||
* A to G and T to C, were more frequent than other mismatches | |||
* reverse transitions, G to A and C to T, were not that frequent | |||
* Nearly 70% of the homopolymer extensions were A/T | |||
* errors were evenly distributed along the length of the reference sequences, they were not evenly distributed | |||
among reads: 82% had no errors, 93% had no more than a single error, and 96% had no more than 2 errors. | |||
* A small number of reads, fewer than 2%, contained a disproportionate number of errors that account for nearly 50% of the miscalls for the entire dataset | |||
* Avg quality is 25; in homopolymers can drop as low as 5 | |||
* Reads much longer than avg length had more errors | |||
* strong correlation between the presence of ambiguous base calls and other errors in a read | |||
* The presence of even a single ambiguous base in a read correlates strongly with the presence of other errors | |||
* Primer errors also correlated with errors | |||
== 454 (paired ends) == | == 454 (paired ends) == | ||
Revision as of 16:18, 21 January 2008
Sanger
454 (single reads)
Anomalies:
* homopolymer lengths can be shorter than real * substitutions less likely than in traditional methodssingle base insertions * carry forward events usually near but not adjacent to homopolymers
GS20
Plate information * 1.6M total wells * 450K detactable wells * 200K usable wells
Accuracy: * published per-base accuracy of a Roche GS20 is only 96%. * Mitch Sogin paper * 99.5% accuracy rate in unassembled sequences * identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better => better quality than Sanger sequencing * The error rate, defined as the number of errors (miscalled bases plus inserted and deleted bases) divided by the total number of expected bases, was 0.49% * 36% insertions, 27% delitions, 21% N's, 16% substitutions * A to G and T to C, were more frequent than other mismatches * reverse transitions, G to A and C to T, were not that frequent * Nearly 70% of the homopolymer extensions were A/T * errors were evenly distributed along the length of the reference sequences, they were not evenly distributed
among reads: 82% had no errors, 93% had no more than a single error, and 96% had no more than 2 errors.
* A small number of reads, fewer than 2%, contained a disproportionate number of errors that account for nearly 50% of the miscalls for the entire dataset * Avg quality is 25; in homopolymers can drop as low as 5 * Reads much longer than avg length had more errors * strong correlation between the presence of ambiguous base calls and other errors in a read * The presence of even a single ambiguous base in a read correlates strongly with the presence of other errors * Primer errors also correlated with errors
454 (paired ends)
Features:
* approximately 84-nucleotide DNA fragments * have a ~ 44-mer linker sequence in the middle * flanked by a ~ 20-mer sequence on each side. * The two flanking 20-mers are segments of DNA that were originally located approximately 2.5 kb apart in the genome of interest. * The ordering and orienting of contigs generates scaffolds which provide a high-quality draft sequence of the genome.
Anomalies:
* the linker can appear (tandem,completely/partially) more than once
Links:
1_paired_end.pdf
Solexa/Illumina
Links:
Strep suis Solexa data set for download at Sanger NCBI Solexa example data set ismb2007Poster.pdf Smith_Rennes_2007.pdf
Software:
Staden & Io_lib * IO_LIB package /fs/sz-user-supported/common/packages/io_lib-1.11-x86_64/bin/ * STADEN package /fs/sz-user-supported/common/packages/staden-src-1-7-0/distrib/unix-rel-1-7-0/linux-bin
Example:
$ solexa2srf s_8_0100_seq.txt -o s_8_0100_seq.srf $ srf2fastq s_8_0100_seq.srf @s_8_100_293_551 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACC + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII @s_8_100_35_698 TATATGATTGACAATATAAAAATATGAGTATAAAAT + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII4/:I @s_8_100_880_947 TTATTATCTTTATTGACGTACCTCTAGAAGACCCAA + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII;>1 ...