Trace formatting: Difference between revisions
Jump to navigation
Jump to search
(→SOLiD) |
|||
Line 55: | Line 55: | ||
[http://minds.nuim.ie/~tkeane/publications/ismb2007Poster.pdf ismb2007Poster.pdf] | [http://minds.nuim.ie/~tkeane/publications/ismb2007Poster.pdf ismb2007Poster.pdf] | ||
[http://www.sb-roscoff.fr/SG/IMG/pdf/Smith_Rennes_2007.pdf Smith_Rennes_2007.pdf] | [http://www.sb-roscoff.fr/SG/IMG/pdf/Smith_Rennes_2007.pdf Smith_Rennes_2007.pdf] | ||
[http://www.genomic.ch/edena/mw2Reads.seq.gz Staphylococcus aureus strain MW2 (edena paper)] | |||
Software: | Software: |
Revision as of 19:18, 13 May 2008
Sanger
454 (single reads)
Anomalies:
* homopolymer lengths can be shorter than real * substitutions less likely than in traditional methodssingle base insertions * carry forward events usually near but not adjacent to homopolymers
GS20
Plate information * 1.6M total wells * 450K detactable wells * 200K usable wells
Accuracy: * published per-base accuracy of a Roche GS20 is only 96%. * Mitch Sogin paper * 99.5% accuracy rate in unassembled sequences * identified several factors that can be used to remove a small percentage of low-quality reads, improving the accuracy to 99.75% or better => better quality than Sanger sequencing * The error rate, defined as the number of errors (miscalled bases plus inserted and deleted bases) divided by the total number of expected bases, was 0.49% * 36% insertions, 27% delitions, 21% N's, 16% substitutions * A to G and T to C, were more frequent than other mismatches * reverse transitions, G to A and C to T, were not that frequent * Nearly 70% of the homopolymer extensions were A/T * errors were evenly distributed along the length of the reference sequences, they were not evenly distributed
among reads: 82% had no errors, 93% had no more than a single error, and 96% had no more than 2 errors.
* A small number of reads, fewer than 2%, contained a disproportionate number of errors that account for nearly 50% of the miscalls for the entire dataset * Avg quality is 25; in homopolymers can drop as low as 5 * Reads much longer than avg length had more errors * strong correlation between the presence of ambiguous base calls and other errors in a read * The presence of even a single ambiguous base in a read correlates strongly with the presence of other errors * Primer errors also correlated with errors
454 (paired ends)
Features:
* approximately 84-nucleotide DNA fragments * have a ~ 44-mer linker sequence in the middle * flanked by a ~ 20-mer sequence on each side. * The two flanking 20-mers are segments of DNA that were originally located approximately 2.5 kb apart in the genome of interest. * The ordering and orienting of contigs generates scaffolds which provide a high-quality draft sequence of the genome.
Anomalies:
* the linker can appear (tandem,completely/partially) more than once
Links:
1_paired_end.pdf
Solexa/Illumina
Links:
Strep suis Solexa data set for download at Sanger NCBI Solexa example data set ismb2007Poster.pdf Smith_Rennes_2007.pdf Staphylococcus aureus strain MW2 (edena paper)
Software:
Staden & Io_lib * IO_LIB package /fs/sz-user-supported/common/packages/io_lib-1.11-x86_64/bin/ * STADEN package /fs/sz-user-supported/common/packages/staden-src-1-7-0/distrib/unix-rel-1-7-0/linux-bin MAQ Sanger assembler FASTQ sequence format
Illumina 1G :
* ~40 Million DNA sequencing reactions * about 36 hours for a run * each sequence is up to 36 bases long
SRA: set of 4 files
*_seq.txt : lane,run, well(x,y) sequence *_prb.txt : max quality from each group of 4 values is taken as quality *_sig2.txt : lane,run, well(x,y); max signal from each group of 4 values corresponds to max quality *_qhg.txt : lane,run, well(x,y); some encoded info?
Qualities:
Range : -5..40 Avg : ~25, depending on the data set
Fastq format
Example:
1 lane of Solexa reads: 10,959 READS; all are 36 bp $ /fs/sz-user-supported/common/packages/io_lib-x86_64/bin/solexa2srf s_8_0100_seq.txt ; mv traces.srf s_8_0100.srf $ /fs/sz-user-supported/common/packages/io_lib-x86_64/bin/srf2fastq s_8_0100.srf > s_8_0100.fastq @s_8_100_293_551 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACC + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII @s_8_100_35_698 TATATGATTGACAATATAAAAATATGAGTATAAAAT + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII4/:I @s_8_100_880_947 TTATTATCTTTATTGACGTACCTCTAGAAGACCCAA + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII;>1 ...
Edge effect: N's have quality -14
$ cat s_8_0100_seq.txt | sort -nk3 -nk4 8 100 0 37 ......AT.AT...TAATCAATA..GA.GAAG.... ... 8 100 1003 959 AGTC.......T.C.........GT.........AA
$ more traces.qual ... >s_8_100_0_37 -14 -14 -14 -14 -14 -14 25 13 -14 25 25 -14 -14 -14 25 25 25 25 22 25 25 25 25 -14 -14 25 25 -14 25 -11 25 14 -14 -14 -14 -14 ... >s_8_100_1003_959 25 25 25 25 -14 -14 -14 -14 -14 -14 -14 25 -14 25 -14 -14 -14 -14 -14 -14 -14 -14 -14 25 -10 -14 -14 -14 -14 -14 -14 -14 -14 -14 8 25 ...
# bioperl script to convrt seq formats $ seqconvert.PLS --from fastq --to fasta < s_8_0100.fastq # get fastq qualities $ more *fastq | grep -A 1 "^+" | grep -v ^+ | grep -v -- ^-- | perl -ane '@F=split //,$F[0]; foreach (@F) { $n=ord($_)-33; print $n," ";} print "\n";'
SOLiD
color space (0123) => base space (ACGT) .csfsta file : in color space; start with a known base (usually T)
Example:
>1_88_1830_R3 G32113123201300232320 >1 _89_1562_R3 G23133131233333101320 ..
Alignment matrix
A C G T A 0 1 2 3 C 1 0 3 2 G 2 3 0 1 T 3 2 1 0
Examples:
AA is encoded as 0 CG is encoded as 3 AACG is encoded as 0 1 3
Features of Color space:
* Color space data are self-complementary
Example: Base A G C T C G T C G T G C A G Color space 2 3 2 2 3 1 2 3 1 1 3 1 2 Complemented Base T C G A G C A G C A C G T C Color space 2 3 2 2 3 1 2 3 1 1 3 1 2
* Two-Base Encoding and Error Recognition 1 change: measuring error multiple changes starting at a certain point: SNP
Example: Reference 2 3 2 2 3 1 2 3 1 1 3 1 2 Observed 2 3 2 2 0 1 2 3 1 1 3 1 2