Dpuiu Assemblathon: Difference between revisions

From Cbcb
Jump to navigation Jump to search
No edit summary
 
(131 intermediate revisions by the same user not shown)
Line 1: Line 1:
= Links =
= Links =
   
   
* http://www.genomeweb.com/informatics/us-european-teams-launch-parallel-challenges-improve-computational-methods-genom
* [http://assemblathon.org/ The Assemblathon] University of California, Santa Cruz & UC Davis;  synthetic & real genome.
* [http://cnag.bsc.es/ dnGASP] De Novo Genome Assembly Assessment Project (dnGASP):  Centro Nacional de Análisis Genómico in Barcelona, Spain, synthetic genome
* [http://gage.cbcb.umd.edu/ GAGE]
* [http://www.genomeweb.com/informatics/us-european-teams-launch-parallel-challenges-improve-computational-methods-genom genomeweb announcement]


= GAGE =
= GAGE =


* Locations
* Location
   /fs/web-cbcb-new/html/gage
   http://gage.cbcb.umd.edu/ -> /fs/web-cbcb-new/html/gage
   /fs/web-cbcb-new/cgi-bin/gage
 
* Answer following questions:
# How much sequencing coverage do I need for my genome project?
# What can I expect the resulting assembly to look like?
# Which assembly software should I use?     
# What parameters should I use when I run the software?
 
= Read correction =
 
* quake
  echo frag_1.fastq      frag_2.fastq      >  genome.ls
  echo shortjump_1.fastq shortjump_2.fastq >> genome.ls
  echo longjump_1.fastq  longjump_2.fastq  >> genome.ls
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/quake.py -f genome.ls  -k 18 -p 20 >&! quake.log


= Assemblers =
= Assemblers =


<pre>
* [http://www.broadinstitute.org/software/allpaths-lg/blog/ Allpaths-LG ] 
* CA            /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/Linux-amd64/bin/runCA  
  paths:
* Newbler
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/allpaths3-35218/
* Velvet
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
* SOAPdenovo
 
* Maq
  RunAllPaths3G \
</pre>
    PRE=$PWD REFERENCE_NAME=. DATA_SUBDIR=. RUN=allpaths SUBDIR=run1.orig THREADS=$P
 
* [http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=Main_Page CA]              
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 
  runCA \
    -d . \
    -p asm \
    -s /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/runCA.parallel.spec \
    doOverlapBasedTrimming=0 ovlOverlapper=ovl unitigger=bog bogBreakAtIntersections=0 bogBadMateDepth=1000 \
    *.frg
 
* [http://www.ebi.ac.uk/~zerbino/velvet/ Velvet]       
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/velvet_1.0.13/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 
  velveth . $K -fastq \
    -shortPaired  frag_12.fastq \
    -shortPaired2 shortjump_12.rev.fastq \
    -shortPaired3 longjump_12.fastq
  velvetg . -exp_cov auto
    -ins_length  $MEA_FRAG      -ins_length_sd  $STD_FRAG \
    -ins_length2 $MEA_SHORTJUMP -ins_length2_sd $STD_SHORTJUMP \
    -ins_length3 $MEA_LONGJUMP  -ins_length3_sd $STD_LONGJUMP \
    -scaffolding yes -exportFiltered yes -unused_reads yes
 
* [http://soap.genomics.org.cn/soapdenovo.html SOAPdenovo]   
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SOAPdenovo-V1.05/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/GapCloser/
 
  echo "[LIB]\navg_ins=$MEA_FRAG\nreverse_seq=0\nasm_flags=1\nrank=1\nq1=frag_1.fastq\nq2=frag_2.fastq\n" >! SOAPdenovo.config
  echo "[LIB]\navg_ins=$MEA_SHORTJUMP\nreverse_seq=1\nasm_flags=2\nrank=2\nq1=shortjump_1.fastq\nq2=shortjump_2.fastq\n" >> SOAPdenovo.config
  echo "[LIB]\navg_ins=$MEA_LONGJUMP\nreverse_seq=0\nasm_flags=2\nrank=4\nq1=longjump_1.fastq\nq2=longjump_2.fastq\n" >> SOAPdenovo.config
  SOAPdenovo all -K $K -p $P -s ./SOAPdenovo.config -o asm
  GapCloser -b SOAPdenovo.config -a asm.scafSeq -o asm2.scafSeq -t $P -p 31
 
* [http://www.genome.umd.edu/SR_CA_MANUAL.htm MSR-CA        Maryland Super-Reads + Celera Assembler.]
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SR-CA-1.1/CA/Linux-amd64/bin/
* [http://www.bcgsc.ca/platform/bioinfo/software/abyss ABYSS]         
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/abyss-1.2.7/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin
 
  abyss-pe  \
    k=$K n=5 name=asm lib='frag short' frag=frag_12.fastq short=short_12.fastq aligner=bowtie
 
* [https://github.com/jts/sga/wiki SGA]           
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/sga/src/SGA/                     # Version: 0.9.8
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin
 
  sga preprocess -p 1 frag_?.fastq > frag.pp.fa
  sga index -t $P frag.pp.fa
  sga correct -k $K -t $P frag.pp.fa -o frag.pp.ec.fa 
  sga index -t $K frag.pp.ec.fa
  sga filter frag.pp.ec.fa
  sga overlap -t $P frag.pp.ec.filter.pass.fa
  sga assemble frag.pp.ec.filter.pass.asqg.gz


= CBCB genomes =
= CBCB genomes =
Line 27: Line 114:
If we can agree on the data sets, then the next step would be to design the experiment - decide in advance which assemblers to run and how many ways to try each one.  I'm thinking we should also trim all the data with Quake.
If we can agree on the data sets, then the next step would be to design the experiment - decide in advance which assemblers to run and how many ways to try each one.  I'm thinking we should also trim all the data with Quake.


== Argentine ant ==
== Bombus impatiens ==
== Bee, Bombus impatiens ==
 
=== Data ===
 
* Estimated haploid genome size: 250M
* 497,318,144 Illumina 124bp reads (246X cvg)
* Reads:
  .        readLen  orientation  insLen  #reads      readCvg  comments 
  frag    124      innie        400    303,118,594  150X    6 libs
  short    124      outie        3-8K    194,199,550  96X      2 libs


Data
* [https://wiki.umiacs.umd.edu/cbcb/index.php/Bumblebee#Traces Online Traces]
* 497,318,144 Illumina 124bp reads
* 8 libraries; inserts:
**  400bp
**  3k (outie)
**  8k (outie)
* [https://wiki.umiacs.umd.edu/cbcb/index.php/Bumblebee#Traces Traces]


Adapters: in 3k & 8k libraries
* Issue: Adapters: in 3k & 8k libraries
  C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
  C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
  3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
  3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
  5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
  5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG


Location:
* Read directories:
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt                            # original fastq files
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt                            # original fastq files
   
   
Line 49: Line 138:
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt          # corrected reads (short inserts)
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt          # corrected reads (short inserts)


== Bacterium, Staph aureus USA300 ==
* Original read files:
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_1_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_1_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_2_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_2_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_3_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_3_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_5_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_5_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_6_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_6_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_7_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_7_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_8_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_8_2_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_9_1_sequence.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/s_9_2_sequence.txt 
 
* Quake corrected files:
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_1_1_sequence.cor.rev.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_1_2_sequence.cor.rev.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_2_1_sequence.cor.rev.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_2_2_sequence.cor.rev.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_3_1_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_3_2_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_5_1_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_5_2_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_6_1_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_6_2_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_7_1_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_7_2_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_8_1_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_8_2_sequence.cor.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_9_1_sequence.cor.rev.txt 
  /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_9_2_sequence.cor.rev.txt
 
* k_unitig corrected files: (in progress --[[User:Dpuiu|Dpuiu]] 10:38, 5 April 2011 (EDT))
 
=== Assembly ===
 
* [[Media:Bombus_impatiens.assembly.summary|Bombus_impatiens.assembly.summary]]
* Assembly directories:                           
CA.quakeCor                /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/                              # Celera Assembly
SOAPdenovo.quakeCor(K=47)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.cor/                        # SOAPdenovo assembly (2011) K=47 quake corrected reads
#SOAPdenovo.orig(K=47)      /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.orig/                      # SOAPdenovo assembly (2011) K=47 original reads 
#SOAPdenovo.quakeCor(K=31)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/                            # SOAPdenovo assembly (2010) K=31 quake corrected reads (prev assembler version)
MSR-CA                    /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/MSR-CA  ; genome9.umd.edu:/genome9/raid/alekseyz/GAGE/bombus/assembly/CA      # MSR-CA
 
== Staph aureus USA300 ==
 
=== Data ===
 
* Complete genome:
  id            len    description
  NC_010079      2872915 Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome
  NC_010063.1    27041  Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence
  NC_012417.1    3125    Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA01-HOU, complete sequence
                2903081 total
 
* Reads (90X):
  .            readLen  insLen  orientation    #reads    readCvg      SRA runs
  frag        101      180    innie          1,294,104  45X          SRR022868
  shortjump    37      3500    outie          3,494,070  45X          SRR022865
 
  [http://trace.ncbi.nlm.nih.gov/Traces/sra/?study=SRP001086 SRP001086] Staphylococcus aureus Sequencing on Illumina
  [http://www.ncbi.nlm.nih.gov/sra/SRX007714?report=full SRX007714] pair lib
  [http://www.ncbi.nlm.nih.gov/sra/SRX007711?report=full SRX007711] jumping lib
 
* Read directories:
  /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/
  /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/
 
* Original read files:
  /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/frag_1.fastq 
  /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/frag_2.fastq 
  /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/short_1.fastq 
  /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/short_2.fastq 
 
* Quake corrected files:
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/frag_1.cor.fastq 
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/frag_2.cor.fastq 
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/short_1.cor.fastq 
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/short_2.cor.fastq
 
* Allpaths-LG corrected files:
  /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/frag_1.cor.fasta 
  /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/frag_2.cor.fasta 
  /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/short_1.cor.fasta 
  /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/short_2.cor.fasta 
 
* k_unitig corrected files:
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/frag_1.cor.seq 
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/frag_2.cor.seq 
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/short_1.cor.seq 
  /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/short_2.cor.seq


  Complete genome       : NC_010079      2872915bp Staphylococcus aureus subsp. aureus USA300_TCH1516
=== Assembly ===
   In progress genome    : NZ_AASB00000000 2810505bp Staphylococcus aureus subsp. aureus USA300_TCH959, 256 contigs
 
* [[Media:Staphylococcus_aureus.genome.summary|Staphylococcus_aureus.genome.summary]]
* Assembly directories:
  allpaths.orig                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpaths
   CA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.orig
  CA.quakeCor                      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.quakeCor.k18
  CA.allpathsCor                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.allpathsCor
  CA.SuperReads                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.SuperReads.latest
  SOAPdenovo.orig(K=31)            /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.orig
  SOAPdenovo.orig(K=47)            /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.orig
  SOAPdenovo.quakeCor(K=31)        /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.quakeCor.k18
  SOAPdenovo.quakeCor(K=47)        /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.quakeCor.k18
  SOAPdenovo.allpathsCor(K=31)      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.allpathsCor
  SOAPdenovo.allpathsCor(K=47)      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.allpathsCor
  velvet.orig                      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.orig
  velvet.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.quakeCor.k18
  velvet.allpathsCor                /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.allpathsCor
 
  ABYSS.quakeCor                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/ABYSS.K31.quakeCor.k18
  SGA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SGA.orig


  454 FLX                : Staphylococcus aureus subsp. aureus USA300_TCH959 HMP0023  http://www.ncbi.nlm.nih.gov/sra/SRX002327?report=full
* SOAPdenovo v1.05 :
  Illumina 101bp paired : Staphylococcus aureus subsp. aureus USA300_TCH1516        http://www.ncbi.nlm.nih.gov/sra/SRX007714?report=full
** new quake version did not help much (quake-0.2.2 vs davek44-error_correction-28dbe11)
** SOAPdenovo map -K 37+ : fails on quakeCor.k18 corrected reads
** "according" to kmerFreq , should probably not use -K >47
** longer kmer => longer scaffolds (K=63 : largest N50scf)
** longer kmer => shorted contigs (K=31 : largest N50ctg)
** K40+ too large: no "valley" in the kmerFreq histogram
  paste SOAPdenovo.K??.quakeCor.k18/genome.K??.kmerFreq | nl0 | head
  paste SOAPdenovo.K??.allpathsCor/genome.K??.kmerFreq | nl0 | more


=== 454FLX ===
== Rhodobacter sphaeroides ==


* Data
=== Data ===
                        reads  min    q1    q2    q3    max        mean      n50        sum           
  sff(original)        334241  36    201    256    277    362        235        264        78432227     
  sffToCA(adaptor free) 325555  51    103    148    208    358        157        185        51225615  # 58723 mates


* DeNovo
* Complete genome: 2 chromosomes, 5 plasmids
   # ctg stats
   id            len    description
   .                     ctgs min q1    q2      q3      max    mean       n50      sum     
   CP000143      3188609 Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence.
   CA.6.1.bog            18   238 21014 135971  239466  567548* 155836    277888*  2805055
  CP000144      943016 Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence.
   newbler.2.5p1.deNovo 100 103 295    3287    39467   229053 27879     78379   2787870
  DQ232586       114045  Rhodobacter sphaeroides 2.4.1 plasmid A, partial sequence.
   CP000145      114178  Rhodobacter sphaeroides 2.4.1 plasmid B, complete sequence.
   CP000146      105284 Rhodobacter sphaeroides 2.4.1 plasmid C, complete sequence.
  CP000147      100828 Rhodobacter sphaeroides 2.4.1 plasmid D, complete sequence.
   DQ232587      37100  Rhodobacter sphaeroides 2.4.1 plasmid E, partial sequence.
                4603060 total
* Reads (90X):
  .           readLen insLen orientation    #reads    readCvg      SRA runs  
   frag        101      180    innie          2,050,868 45X          SRR081522
  shortjump    101     3500   outie          2,050,868  45X          SRR034528


  # scf stats
* SRA traces
   CA.6.1.bog            6   284  21014  173065  1032129 1458733* 467554    1458733* 2805325
   [http://www.ncbi.nlm.nih.gov/sra/SRX033397?report=full SRX033397] pair lib ;   readLen=101 ; insMea=180
   newbler.2.5p1.deNovo  8    2475 20731  110137  1030785 1408642  349895    1408642  2799157
   [http://www.ncbi.nlm.nih.gov/sra/SRX016063?report=full SRX016063] jumping lib ; readLen=101 ; insMea~=3455; ~15% of the mates are short inserts (~250bp)


* Reference based(Saureus USA300)
* Original read files:
  .                   ctgs min q1    q2      q3      max    mean      n50      sum     
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminap/frag_1.fastq  
   newbler.2.3.refMapper 206 103  556    3098    15366   117487 12749      40687    2626469
   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminap/frag_2.fastq 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminaj/short_1.fastq  
   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminaj/short_2.fastq  


=== Illumina101.78X.cor ===
* Quake corrected read files:
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/frag_1.cor.fastq 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/frag_2.cor.fastq 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/short_1.cor.fastq 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/short_2.cor.fastq 


* Comments:
* QuakeIter2 corrected read files:
   mated reads; lib mea/srd (CA estimates)=170/21
   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/frag_1.cor.fastq 
   first 2 and last base show composition bias; should we trim them???
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/frag_2.cor.fastq 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/short_1.cor.fastq 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/short_2.cor.fastq 
 
* Allpaths-LG corrected files:
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/frag_1.cor.fasta 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/frag_2.cor.fasta 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/short_1.cor.fasta 
  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/short_2.cor.fasta 
 
* k_unitig corrected files:
  /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/frag_1.cor.seq 
  /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/frag_2.cor.seq 
  /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/short_1.cor.seq 
  /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/short_2.cor.seq
 
=== Assembly ===
 
* [[Media:Rhodobacter_sphaeroides.assembly.summary|Rhodobacter_sphaeroides.assembly.summary]]
* [[Media:Rhodobacter_sphaeroides.runCA|Rhodobacter_sphaeroides.runCA]] modified CA run
 
* Assembly directories:
   allpaths.orig                    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpaths
    
    
* Data
  CA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.orig
                     reads      min    max        mean sum            cvg
  CA.quakeCor                     /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.quakeCor.k18
   Total              30,597,352 101    101        101   3090332552    1065
  CA.allpathsCor                  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.allpathsCor
   Sampled           2,295,176   101    101       101   231812776      78
   
   Corrected(paired)  1,479,510   30    101        89    131973249      45.9
   CA.SuperReads                    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.SuperReads.latest
   
   SOAPdenovo.orig(K=31)            /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.orig/K31
   SOAPdenovo.orig(K=47)           /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.orig
  SOAPdenovo.quakeCor(K=31)        /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.quakeCor.k18/K31
   SOAPdenovo.quakeCor(K=47)       /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.quakeCor.k18
   SOAPdenovo.allpathsCor(K=31)    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.allpathsCor/K31
   SOAPdenovo.allpathsCor(K=47)     /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.allpathsCor
  velvet.orig                      /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.orig
  velvet.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.quakeCor
  velvet.allpathsCor              /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.allpathsCor
   
  ABYSS.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/ABYSS.K31.quakeCor.k18
 
   SGA.orig                        /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SGA.quakeCor.k18


* DeNovo
== Human, a single chromosome, medium-sized ==
  # ctg stats
              elem  min  q1    q2    q3    max    mean  n50    sum      q.0cvg r.0cvg 1.0cvg  1.snps  1.breaks.all  1.breaks.1k+
  CA.bog      73    1716  14503  26431  52086  148524* 39043  58038* 2850157  31075  7700  31075  75      14            6 
  SOAPdenovo  9382  32    32    52    63    85850  347    16726  3259522  34960  722    37358  24      0            0 
  velvet      453  61    85    224    3279  137163  6297  36496  2852552  53075  10478  53410  156    17            6 


  # scf stats
=== Data ===
              elem  min  q1    q2    q3    max    mean  n50    sum      q.0cvg r.0cvg 1.0cvg  1.snps  1.breaks.all  1.breaks.1k+
  CA.bog      67    1716  14869  32929  58038  148524* 42541  65383* 2850277  31075  7700  31075  75      20            7              # 1 large rearangement :  scf120001252361 : NC_010079:622381-671743
  SOAPdenovo  186  100  333    1528  17623  144079  15625  55558  2906207  61878  26070  62049  65      453          6 
  velvet      427  61    82    177    2982  137163  6685  37874  2854649  53268  10478  53623  156    42            8


* Location
* Latest online assembly
   /fs/szattic-asmg4/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100.78X/
   ftp://ftp.ncbi.nih.gov/genomes/H_sapiens/Assembled_chromosomes/seq/
  /fs/szattic-asmg4/dpuiu/HTS/Staphylococcus_aureus/Assembly//Illuminap100.78X.cor/
  NC_000014.8    107,349,540  # total, with telomeric N's
                  88,289,540  # clean


=== Illumina101.150X.cor ===
* Human bowtie indexes
  /fs/szdata/bowtie_indexes/h_sapiens_37_asm


* Comments:
* Chr14 filtered reads (69.3X):
   first 2 and last base show composition bias; should we trim them???
   .            readLen  insLen        orientation    #reads        readCvg       
  frag        101      155          innie          36,504,800    42
  shortjump    101      2283-2803    outie          22,669,408    26
  longjump    76-101  35295-35318  innie          2,405,064    1.3


* Data
* Illumina reads (all genome)
                    reads       min    max        mean  sum            cvg
   [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP003680 Human NA12878 Genome on Illumina]
   Total              30,597,352  101    101        101  3090332552    1065
   ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra-instant/reads/ByStudy/litesra/SRP/SRP003/SRP003680/
   Sampled            4,404,626  101    101        101  444867226      154
   ginko:/scratch1/Human_NA12878_on_Illumina/
   Corrected(paired)  2,815,584  30    101        89    252331825      87


* DeNovo
  #Fragment (mean insert size: 155bp, SD 26), 101 bp read length
   # ctg stats
   Lib          #Spots  #Bases  #Reads    #Mates    ReadLen  InsMea  InStd  InsMin  InsMax  TrimReadLen    Comments
              elem min   q1     q2     q3     max     mean   n50     sum     q.0cvg r.0cvg 1.0cvg 1.snps 1.breaks.all 1.breaks.1k+
  SRR067787    82.4M  16.6G  652448124  324283604 101      155    26    77      458                    Human HapMap individual NA12878 HiSeq 2000
   CA.bog      47   1866 11740 37171 88747 388257* 60272 121078* 2832762 39703 28204 39775   142    12            9  
  SRR067789    82.6M  16.7G   654133372  324876520  101      155     26     77      458      
   SOAPdenovo   15229 32   33    48    63    74601   232   13773   3530251 31690 269   36416   17     0            0  
  SRR067780    83.3M  16.8G  660001672  328021140  101      155    26    77      458      
   velvet       429   61   86    206   3147   134034 6650   40448   2852695 52754 9400   52940   152    24            9  
  SRR067791    83.0M  16.8G  657963460  327205952  101      155    26    77      458   
  SRR067793    77.0M  15.5G   609634756  303094956  101      155     26    77     458   
  SRR067784    83.3M  16.8G  660118460  328244560  101      155    26    77      458   
  SRR067785    81.6M  16.5G  646350512 321174108  101      155    26    77      458   
  SRR067792    83.8M  16.9G  663997828  330084304  101      155    26    77      458                     
   
  SRR067577    46.3M  9.3G    367673108  183472948 101      155    26    77      458                      Human HapMap individual NA12878 Illumina GAII
  SRR067579    46.0M  9.3G    365743380  182532676  101      155    26    77      458   
   SRR067578    46.5M  9.4G    369557476  184410788  101      155    26    77      458   
 
  #Jumping1 (mean insert size: 2283bp, SD 221), 101 bp read length
  SRR067771   81.5M  16.5G  644846296 320822716 101      2283    221    1620    2586                    Human HapMap individual NA12878 HiSeq 2000
  SRR067777    82.6M  16.7G  653163608 325232944 101      2283    221    1620    2586   
  SRR067781    82.1M  16.6G  649748720 323656576 101      2283    221    1620    2586   
  SRR067776    79.9M  16.1G  632590344 315165892 101      2283    221    1620    2586   
 
  #Jumping2 (mean insert size: 2803bp, SD 271), 101 bp read length
   SRR067773    93.1M  18.8G  736456192  366884512 101      2803    271    1990    3106                      Human HapMap individual NA12878 HiSeq 2000
   SRR067779    94.0M   19.0G  743564440  370214028  101      2803    271    1990   3106   
   SRR067778   97.3M  19.6G   767984324 381879652 101      2803   271    1990    3106   
   SRR067786    94.6M  19.1G  747631104  372002548  101     2803    271    1990    3106   
 
  #Fosmid1 (mean insert size: 35295bp, SD 2703), 76 bp read length
   SRR068214    13.1M  2.0G    104505420  52087176  76       35295   2703  27186  35523  36(trim 20bp at 5',20bp at 3')      Human HapMap individual NA12878 Illumina GAII
  SRR068211    4.8M   736.9M  38612196  19252408  76      35295  2703  27186  35523  36(trim 20bp at 5',20bp at 3')      Human HapMap individual NA12878 Illumina GAII
 
  #Fosmid2 (mean insert size: 35318bp, SD 2759),  101 bp read length
  SRR068335   67.4M  13.6G  533805860  265481252  101      35318  2759  27041  35621  61(trim 20bp at 5',20bp at 3')      Human HapMap individual NA12878 HiSeq 2000
 
* Comments
** Human chromosome 14.  The chromosome may change, but this is a new data set with 100X coverage in 100bp and 76bp reads, just assembled by the Broad group using Allpaths-LG and Soap.  We've downloaded the data and Todd is going to create a data set representing just chr 14, to make it feasible.  We'll then try to assemble that data w/all 3 assemblers: CA, SOAP, Allpaths-LG.
 
* Illumina chr14 reads (aligned with bowtie & corrected)
   /fs/szattic-asmg8/treangen/*fastq
  hard to align: bowtie -5 20 -3 20 -e 1000 ...
  jumping reads: only the ones aligned within coorect mean, stdev selected; these libraries usually have a high % of short inserts!!!
 
* Original read files:
  /fs/szattic-asmg8/treangen/chr14_fragment_1.fastq  
   /fs/szattic-asmg8/treangen/chr14_fragment_2.fastq 
   /fs/szattic-asmg8/treangen/chr14_shortjump_1.fastq  
  /fs/szattic-asmg8/treangen/chr14_shortjump_2.fastq  
   /fs/szattic-asmg8/treangen/chr14_longjump_1.fastq 
   /fs/szattic-asmg8/treangen/chr14_longjump_2.fastq  


  # scf stats
* Quake corrected files:
              elem  min  q1    q2    q3    max    mean   n50    sum      q.0cvg r.0cvg 1.0cvg  1.snps 1.breaks.all 1.breaks.1k+
   /fs/szattic-asmg8/treangen/chr14_fragment_1.cor.fastq 
   CA.bog      46    1866  11740  39650  88747  388257* 61582  129426* 2832782  39703  28204  39775  142    13            10  
  /fs/szattic-asmg8/treangen/chr14_fragment_2.cor.fastq  
   SOAPdenovo  158  101  202    1249  20910  150305  18353  74149  2899760  64028  30903 64392  52      506          7 
  /fs/szattic-asmg8/treangen/chr14_shortjump_1.cor.fastq  
   velvet      409  61    85    180    2854  142341  6978  42466  2853854  52940 9400  52751  150    43            12
   /fs/szattic-asmg8/treangen/chr14_shortjump_2.cor.fastq  
   /fs/szattic-asmg8/treangen/chr14_longjump_1.cor.fastq  
   /fs/szattic-asmg8/treangen/chr14_longjump_2.cor.fastq  


== Bacterium, E coli ==
* Allpaths-LG corrected files:
  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_fragment_1.cor.fasta
  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_fragment_2.cor.fasta
  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_shortjump_1.cor.fasta
  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_shortjump_2.cor.fasta
  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_longjump_1.cor.fasta
  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_longjump_2.cor.fasta


   Compelte genome        : NC_000913      4639675bp Escherichia coli str. K-12 substr. MG1655
=== Assembly ===
 
* [[Media:Homo_sapiens.assembly.summary|Homo_sapiens.assembly.summary]]
 
* Assembly directories
 
  allpaths                        /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpaths
  CA.allpathsCor                  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/CA.allpathsCor , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/CA.allpathsCor             
  CA.quakeCor                      /fs/szattic-asmg8/tmagoc/GAGE/human
   CA.SuperReads                    ginkgo:/scratch1/dpuiu/HTS/Homo_sapiens/Assembly/CA.SuperReads
   
  SOAPdenovo.orig(K=47)          /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.orig/
  SOAPdenovo.quakeCor(K=31)      /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/K31    , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/K31
  SOAPdenovo.quakeCor(K=47)      /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/      , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor
  SOAPdenovo.allpathsCor(K=31)    /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor/K31 , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor/K31
  SOAPdenovo.allpathsCor(K=47)    /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor
   
   
   454 FLX                : Escherichia coli str. K-12 substr. MG1655                 http://www.ncbi.nlm.nih.gov/sra/SRX000348?report=full
   velvet.quakeCor                /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/velvet.quakeCor
   Illumina 101bp paired  : Escherichia coli str. K-12 substr. MG1655                  http://www.ncbi.nlm.nih.gov/sra/SRX016044?report=full
  ABYSS.quakeCor                 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/ABYSS.K31.quakeCor.K18  ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/ABYSS.K31.quakeCor.K18
  SGA.orig                        /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SGA.orig                ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SGA.orig
 
=== Allpaths-lg ===
 
* Read counts
                              orig      cor              cor(paired,all >64bp)
   chr14_fragment_12.fastq    36504800  35571477(97.44%)  34268444(10+bp ovl F/R)
  chr14_shortjump_12.fastq    22669408  11255320(49.64%)  11255320
  chr14_longjump_12.fastq    2405064    187398  (7.79%)  187398 


=== Illumina101.cor ===
* Assembly stats:
  .         elem  min    q1    q2    q3      max      mean    n50      sum     
  scf        418  96    131    256    1236    81646936  209781  81646936  87688255 
  scf10K+    17    10330  11780  26536  269876  81646936  5135452  81646936  87302692 
  ctg        4722  96    2342  9101  24174  240773    17887    36530      84461065 


* Data
* Runtime 1104299.893u 126549.756s 18:50:05.80 1815.2%    0+0k 0+0io 8463pf+0w
   mated reads; lib mea/srd (CA estimates)=160/24
   18hr 50min :                  multiprocessor
  1104299/(3600*24)=12.78 days : singleprocessor


                    reads      min    max        mean  sum            cvg
== Argentine ant ==
  Total              20,635,060  101    101        101  2084141060    449
  Sampled            3,591,676  101    101        101  362759276      78
  Corrected(paired)  1,556,316  30    101        79    122785294      26


* DeNovo
=== Data ===
  #ctg stats
                      elem      min    q1    q2    q3    max        mean      n50        sum        q.0cvg  r.0cvg  1.0cvg  1.snps  1.breaks.all  1.breaks.1k+
  CA.bog              677        1006  2265  4527  8853  45500      6604      10186      4471053    189441  162537  190445  170    16            4 
  SOAPdenovo          4000      32    35    57    101    43816      1172      9327      4687158    63179  3026    78607  67      1            0 
  velvet              711        61    166    2135  8579  57936*    6375      16400*    4532895    113612  30252  114128  166    31            5 


   # scf stats
          #reads        readLen   readCvg
                      elem      min   q1    q2    q3    max       mean      n50        sum        q.0cvg  r.0cvg  1.0cvg  1.snps  1.breaks.all  1.breaks.1k+
  Shotgun: 39,741,216   75       12
   CA.bog              658       1006  2343  4621  9033  45500      6795      10483      4471433    189441  162537  190445 170    35            4 
   3kb:    46,435,880    75       13  
   SOAPdenovo          270       100    269    3431   24735  219248*    17273      53882*    4663670    111651  71505   112331  128    826          2    
   8kb:    43,839,748    75       13
  velvet              480       61    92    1147  13028  114907    9523      32233      4571240    113936  30253  114192  161    262          11
   Total:   130,016,844   75       40


* Location
* Location
   /fs/szattic-asmg4/dpuiu/HTS/Escherichia_coli/Data/Illuminap100/
   /fs/szattic-asmg7/argentine_ant/Illumina/
  /fs/szattic-asmg4/dpuiu/HTS/Escherichia_coli/Assembly/Illuminap100.cor/


== Human, a single chromosome, medium-sized ==
= UC Assemblaton1 =
 
* [http://www.drive5.com/evolver/ Evolver]
* [https://github.com/jstjohn/SimSeq Read simulator]
* [http://korflab.ucdavis.edu/Datasets/Assemblathon/Assemblathon1/ Data download]
* speciesA.diploid.fa len
  chr0_1        76252953
  chr0_2        76285600
  chr1_1        18509915
  chr1_2        18539192
  chr2_1        17699484
  chr2_2        17710169


* Data
= UC Assemblaton1 =
  [http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP003680 Human NA12878 Genome on Illumina]
...
  ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra-instant/reads/ByStudy/litesra/SRP/SRP003/SRP003680/
  ginko:/scratch1/Human_NA12878_on_Illumina/100x

Latest revision as of 17:07, 1 August 2011

Links

  • The Assemblathon University of California, Santa Cruz & UC Davis; synthetic & real genome.
  • dnGASP De Novo Genome Assembly Assessment Project (dnGASP): Centro Nacional de Análisis Genómico in Barcelona, Spain, synthetic genome
  • GAGE
  • genomeweb announcement

GAGE

  • Location
 http://gage.cbcb.umd.edu/ -> /fs/web-cbcb-new/html/gage
  • Answer following questions:
  1. How much sequencing coverage do I need for my genome project?
  2. What can I expect the resulting assembly to look like?
  3. Which assembly software should I use?
  4. What parameters should I use when I run the software?

Read correction

  • quake
 echo frag_1.fastq      frag_2.fastq      >  genome.ls
 echo shortjump_1.fastq shortjump_2.fastq >> genome.ls
 echo longjump_1.fastq  longjump_2.fastq  >> genome.ls 

 /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/quake.py -f genome.ls  -k 18 -p 20 >&! quake.log

Assemblers

 paths: 
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/allpaths3-35218/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/

 RunAllPaths3G \
    PRE=$PWD REFERENCE_NAME=. DATA_SUBDIR=. RUN=allpaths SUBDIR=run1.orig THREADS=$P

 paths: 
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/

 runCA \
    -d . \
    -p asm \
    -s /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/runCA.parallel.spec \
    doOverlapBasedTrimming=0 ovlOverlapper=ovl unitigger=bog bogBreakAtIntersections=0 bogBadMateDepth=1000 \
    *.frg

 paths: 
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/velvet_1.0.13/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/

 velveth . $K -fastq \ 
   -shortPaired  frag_12.fastq \
   -shortPaired2 shortjump_12.rev.fastq \
   -shortPaired3 longjump_12.fastq

 velvetg . -exp_cov auto 
   -ins_length  $MEA_FRAG      -ins_length_sd  $STD_FRAG \
   -ins_length2 $MEA_SHORTJUMP -ins_length2_sd $STD_SHORTJUMP \
   -ins_length3 $MEA_LONGJUMP  -ins_length3_sd $STD_LONGJUMP \
   -scaffolding yes -exportFiltered yes -unused_reads yes

 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SOAPdenovo-V1.05/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/GapCloser/

 echo "[LIB]\navg_ins=$MEA_FRAG\nreverse_seq=0\nasm_flags=1\nrank=1\nq1=frag_1.fastq\nq2=frag_2.fastq\n" >! SOAPdenovo.config
 echo "[LIB]\navg_ins=$MEA_SHORTJUMP\nreverse_seq=1\nasm_flags=2\nrank=2\nq1=shortjump_1.fastq\nq2=shortjump_2.fastq\n" >> SOAPdenovo.config
 echo "[LIB]\navg_ins=$MEA_LONGJUMP\nreverse_seq=0\nasm_flags=2\nrank=4\nq1=longjump_1.fastq\nq2=longjump_2.fastq\n" >> SOAPdenovo.config

 SOAPdenovo all -K $K -p $P -s ./SOAPdenovo.config -o asm

 GapCloser -b SOAPdenovo.config -a asm.scafSeq -o asm2.scafSeq -t $P -p 31

 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SR-CA-1.1/CA/Linux-amd64/bin/


 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/abyss-1.2.7/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin

 abyss-pe  \
   k=$K n=5 name=asm lib='frag short' frag=frag_12.fastq short=short_12.fastq aligner=bowtie

 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/sga/src/SGA/                      # Version: 0.9.8
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin

 sga preprocess -p 1 frag_?.fastq > frag.pp.fa 
 sga index -t $P frag.pp.fa 

 sga correct -k $K -t $P frag.pp.fa -o frag.pp.ec.fa  
 sga index -t $K frag.pp.ec.fa 

 sga filter frag.pp.ec.fa 
 sga overlap -t $P frag.pp.ec.filter.pass.fa

 sga assemble frag.pp.ec.filter.pass.asqg.gz

CBCB genomes

  • a bacterial genome. Instead of E. coli, we can use S. aureus USA300, which has sequence data in SRA from 454 and Illumina, paired and unpaired. Daniela has already assemblied it using CA, Newbler, Velvet, SOAPdenovo, and Maq (using its comparative assembly mode, where it aligns to a reference).
  • A medium-sized eukaryote. I'd like to use the Argentine ant or the Bombus impatiens bee - I've just written to Gene Robinson to ask about the bee.
  • Another eukaryote, ideally a larger one. Human would be great, but we just don't have enough time to do multiple human assemblies. So maybe another insect, or perhaps a plant if we can find one for which data is available.

If we can agree on the data sets, then the next step would be to design the experiment - decide in advance which assemblers to run and how many ways to try each one. I'm thinking we should also trim all the data with Quake.

Bombus impatiens

Data

  • Estimated haploid genome size: 250M
  • 497,318,144 Illumina 124bp reads (246X cvg)
  • Reads:
 .        readLen  orientation  insLen  #reads       readCvg  comments   
 frag     124      innie        400     303,118,594  150X     6 libs 
 short    124      outie        3-8K    194,199,550  96X      2 libs
  • Issue: Adapters: in 3k & 8k libraries
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
  • Read directories:
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt                             # original fastq files

/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[129]_[012]_sequence.cor.rev.txt        # adaptor free corrected reads (long inserts)
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt          # corrected reads (short inserts)
  • Original read files:
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_1_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_1_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_2_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_2_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_3_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_3_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_5_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_5_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_6_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_6_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_7_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_7_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_8_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_8_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_9_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_9_2_sequence.txt
  • Quake corrected files:
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_1_1_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_1_2_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_2_1_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_2_2_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_3_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_3_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_5_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_5_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_6_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_6_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_7_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_7_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_8_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_8_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_9_1_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_9_2_sequence.cor.rev.txt
  • k_unitig corrected files: (in progress --Dpuiu 10:38, 5 April 2011 (EDT))

Assembly

CA.quakeCor                /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/                               # Celera Assembly

SOAPdenovo.quakeCor(K=47)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.cor/                         # SOAPdenovo assembly (2011) K=47 quake corrected reads
#SOAPdenovo.orig(K=47)      /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.orig/                       # SOAPdenovo assembly (2011) K=47 original reads   
#SOAPdenovo.quakeCor(K=31)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/                            # SOAPdenovo assembly (2010) K=31 quake corrected reads (prev assembler version)

MSR-CA                     /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/MSR-CA  ; genome9.umd.edu:/genome9/raid/alekseyz/GAGE/bombus/assembly/CA       # MSR-CA

Staph aureus USA300

Data

  • Complete genome:
 id             len     description
 NC_010079      2872915 Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome
 NC_010063.1    27041   Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence
 NC_012417.1    3125    Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA01-HOU, complete sequence
                2903081 total
  • Reads (90X):
 .            readLen  insLen  orientation     #reads     readCvg      SRA runs
 frag         101      180     innie           1,294,104  45X          SRR022868 
 shortjump    37       3500    outie           3,494,070  45X          SRR022865 

 SRP001086 Staphylococcus aureus Sequencing on Illumina
 SRX007714 pair lib
 SRX007711 jumping lib
  • Read directories:
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/
  • Original read files:
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/frag_1.fastq  
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/frag_2.fastq  
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/short_1.fastq  
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/short_2.fastq
  • Quake corrected files:
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/frag_1.cor.fastq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/frag_2.cor.fastq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/short_1.cor.fastq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/short_2.cor.fastq
  • Allpaths-LG corrected files:
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/frag_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/frag_2.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/short_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/short_2.cor.fasta
  • k_unitig corrected files:
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/frag_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/frag_2.cor.seq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/short_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/short_2.cor.seq

Assembly

 allpaths.orig                     /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpaths

 CA.orig                           /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.orig
 CA.quakeCor                       /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.quakeCor.k18
 CA.allpathsCor                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.allpathsCor
 CA.SuperReads                     /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.SuperReads.latest

 SOAPdenovo.orig(K=31)             /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.orig
 SOAPdenovo.orig(K=47)             /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.orig
 SOAPdenovo.quakeCor(K=31)         /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.quakeCor.k18
 SOAPdenovo.quakeCor(K=47)         /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.quakeCor.k18
 SOAPdenovo.allpathsCor(K=31)      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.allpathsCor
 SOAPdenovo.allpathsCor(K=47)      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.allpathsCor

 velvet.orig                       /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.orig
 velvet.quakeCor                   /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.quakeCor.k18 
 velvet.allpathsCor                /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.allpathsCor
 
 ABYSS.quakeCor                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/ABYSS.K31.quakeCor.k18
 SGA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SGA.orig
  • SOAPdenovo v1.05 :
    • new quake version did not help much (quake-0.2.2 vs davek44-error_correction-28dbe11)
    • SOAPdenovo map -K 37+ : fails on quakeCor.k18 corrected reads
    • "according" to kmerFreq , should probably not use -K >47
    • longer kmer => longer scaffolds (K=63 : largest N50scf)
    • longer kmer => shorted contigs (K=31 : largest N50ctg)
    • K40+ too large: no "valley" in the kmerFreq histogram
 paste SOAPdenovo.K??.quakeCor.k18/genome.K??.kmerFreq | nl0 | head
 paste SOAPdenovo.K??.allpathsCor/genome.K??.kmerFreq | nl0 | more

Rhodobacter sphaeroides

Data

  • Complete genome: 2 chromosomes, 5 plasmids
 id             len     description
 CP000143       3188609 Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence.
 CP000144       943016  Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence.
 DQ232586       114045  Rhodobacter sphaeroides 2.4.1 plasmid A, partial sequence.
 CP000145       114178  Rhodobacter sphaeroides 2.4.1 plasmid B, complete sequence.
 CP000146       105284  Rhodobacter sphaeroides 2.4.1 plasmid C, complete sequence.
 CP000147       100828  Rhodobacter sphaeroides 2.4.1 plasmid D, complete sequence.
 DQ232587       37100   Rhodobacter sphaeroides 2.4.1 plasmid E, partial sequence.
                4603060 total
  • Reads (90X):
 .            readLen  insLen  orientation     #reads     readCvg      SRA runs  
 frag         101      180     innie           2,050,868  45X          SRR081522 
 shortjump    101      3500    outie           2,050,868  45X          SRR034528
  • SRA traces
 SRX033397 pair lib ;    readLen=101 ; insMea=180 
 SRX016063 jumping lib ; readLen=101 ; insMea~=3455; ~15% of the mates are short inserts (~250bp)
  • Original read files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminap/frag_1.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminap/frag_2.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminaj/short_1.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminaj/short_2.fastq
  • Quake corrected read files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/frag_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/frag_2.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/short_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/short_2.cor.fastq
  • QuakeIter2 corrected read files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/frag_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/frag_2.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/short_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/short_2.cor.fastq
  • Allpaths-LG corrected files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/frag_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/frag_2.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/short_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/short_2.cor.fasta
  • k_unitig corrected files:
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/frag_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/frag_2.cor.seq  
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/short_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/short_2.cor.seq

Assembly

  • Assembly directories:
 allpaths.orig                    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpaths
 
 CA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.orig
 CA.quakeCor                      /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.quakeCor.k18
 CA.allpathsCor                   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.allpathsCor

 CA.SuperReads                    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.SuperReads.latest

 SOAPdenovo.orig(K=31)            /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.orig/K31
 SOAPdenovo.orig(K=47)            /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.orig
 SOAPdenovo.quakeCor(K=31)        /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.quakeCor.k18/K31
 SOAPdenovo.quakeCor(K=47)        /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.quakeCor.k18
 SOAPdenovo.allpathsCor(K=31)     /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.allpathsCor/K31
 SOAPdenovo.allpathsCor(K=47)     /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.allpathsCor

 velvet.orig                      /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.orig
 velvet.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.quakeCor
 velvet.allpathsCor               /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.allpathsCor

 ABYSS.quakeCor                   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/ABYSS.K31.quakeCor.k18
 
 SGA.orig                         /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SGA.quakeCor.k18

Human, a single chromosome, medium-sized

Data

  • Latest online assembly
 ftp://ftp.ncbi.nih.gov/genomes/H_sapiens/Assembled_chromosomes/seq/
  NC_000014.8    107,349,540  # total, with telomeric N's 
                  88,289,540  # clean
  • Human bowtie indexes
  /fs/szdata/bowtie_indexes/h_sapiens_37_asm
  • Chr14 filtered reads (69.3X):
 .            readLen  insLen        orientation    #reads        readCvg        
 frag         101      155           innie          36,504,800    42
 shortjump    101      2283-2803     outie          22,669,408    26
 longjump     76-101   35295-35318   innie          2,405,064     1.3
  • Illumina reads (all genome)
 Human NA12878 Genome on Illumina 
 ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra-instant/reads/ByStudy/litesra/SRP/SRP003/SRP003680/
 ginko:/scratch1/Human_NA12878_on_Illumina/

 #Fragment (mean insert size: 155bp, SD 26), 101 bp read length
 Lib          #Spots  #Bases  #Reads     #Mates     ReadLen  InsMea  InStd  InsMin  InsMax   TrimReadLen    Comments
 SRR067787    82.4M   16.6G   652448124  324283604  101      155     26     77      458                     Human HapMap individual NA12878 HiSeq 2000
 SRR067789    82.6M   16.7G   654133372  324876520  101      155     26     77      458     
 SRR067780    83.3M   16.8G   660001672  328021140  101      155     26     77      458     
 SRR067791    83.0M   16.8G   657963460  327205952  101      155     26     77      458     
 SRR067793    77.0M   15.5G   609634756  303094956  101      155     26     77      458     
 SRR067784    83.3M   16.8G   660118460  328244560  101      155     26     77      458     
 SRR067785    81.6M   16.5G   646350512  321174108  101      155     26     77      458     
 SRR067792    83.8M   16.9G   663997828  330084304  101      155     26     77      458                      

 SRR067577    46.3M   9.3G    367673108  183472948  101      155     26     77      458                      Human HapMap individual NA12878 Illumina GAII
 SRR067579    46.0M   9.3G    365743380  182532676  101      155     26     77      458     
 SRR067578    46.5M   9.4G    369557476  184410788  101      155     26     77      458     
 
 #Jumping1 (mean insert size: 2283bp, SD 221), 101 bp read length
 SRR067771    81.5M   16.5G   644846296  320822716  101      2283    221    1620    2586                     Human HapMap individual NA12878 HiSeq 2000
 SRR067777    82.6M   16.7G   653163608  325232944  101      2283    221    1620    2586    
 SRR067781    82.1M   16.6G   649748720  323656576  101      2283    221    1620    2586    
 SRR067776    79.9M   16.1G   632590344  315165892  101      2283    221    1620    2586    
 
 #Jumping2 (mean insert size: 2803bp, SD 271), 101 bp read length
 SRR067773    93.1M   18.8G   736456192  366884512  101      2803    271    1990    3106                      Human HapMap individual NA12878 HiSeq 2000
 SRR067779    94.0M   19.0G   743564440  370214028  101      2803    271    1990    3106    
 SRR067778    97.3M   19.6G   767984324  381879652  101      2803    271    1990    3106    
 SRR067786    94.6M   19.1G   747631104  372002548  101      2803    271    1990    3106    
 
 #Fosmid1  (mean insert size: 35295bp, SD 2703), 76 bp read length
 SRR068214    13.1M   2.0G    104505420  52087176   76       35295   2703   27186   35523   36(trim 20bp at 5',20bp at 3')       Human HapMap individual NA12878 Illumina GAII
 SRR068211    4.8M    736.9M  38612196   19252408   76       35295   2703   27186   35523   36(trim 20bp at 5',20bp at 3')       Human HapMap individual NA12878 Illumina GAII
 
 #Fosmid2 (mean insert size: 35318bp, SD 2759),  101 bp read length
 SRR068335    67.4M   13.6G   533805860  265481252  101      35318   2759   27041   35621   61(trim 20bp at 5',20bp at 3')       Human HapMap individual NA12878 HiSeq 2000
  • Comments
    • Human chromosome 14. The chromosome may change, but this is a new data set with 100X coverage in 100bp and 76bp reads, just assembled by the Broad group using Allpaths-LG and Soap. We've downloaded the data and Todd is going to create a data set representing just chr 14, to make it feasible. We'll then try to assemble that data w/all 3 assemblers: CA, SOAP, Allpaths-LG.
  • Illumina chr14 reads (aligned with bowtie & corrected)
 /fs/szattic-asmg8/treangen/*fastq
 hard to align: bowtie -5 20 -3 20 -e 1000 ...
 jumping reads: only the ones aligned within coorect mean, stdev selected; these libraries usually have a high % of short inserts!!!
  • Original read files:
 /fs/szattic-asmg8/treangen/chr14_fragment_1.fastq  
 /fs/szattic-asmg8/treangen/chr14_fragment_2.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_1.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_2.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_1.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_2.fastq
  • Quake corrected files:
 /fs/szattic-asmg8/treangen/chr14_fragment_1.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_fragment_2.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_1.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_2.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_1.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_2.cor.fastq
  • Allpaths-LG corrected files:
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_fragment_1.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_fragment_2.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_shortjump_1.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_shortjump_2.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_longjump_1.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_longjump_2.cor.fasta

Assembly

  • Assembly directories
 allpaths                         /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpaths

 CA.allpathsCor                   /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/CA.allpathsCor , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/CA.allpathsCor               
 CA.quakeCor                      /fs/szattic-asmg8/tmagoc/GAGE/human
 CA.SuperReads                    ginkgo:/scratch1/dpuiu/HTS/Homo_sapiens/Assembly/CA.SuperReads

 SOAPdenovo.orig(K=47)           /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.orig/ 
 SOAPdenovo.quakeCor(K=31)       /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/K31    , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/K31
 SOAPdenovo.quakeCor(K=47)       /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/       , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor 
 SOAPdenovo.allpathsCor(K=31)    /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor/K31 , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor/K31
 SOAPdenovo.allpathsCor(K=47)    /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor ,     /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor

 velvet.quakeCor                 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/velvet.quakeCor

 ABYSS.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/ABYSS.K31.quakeCor.K18  ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/ABYSS.K31.quakeCor.K18

 SGA.orig                        /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SGA.orig                ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SGA.orig

Allpaths-lg

  • Read counts
                             orig       cor               cor(paired,all >64bp)
 chr14_fragment_12.fastq     36504800   35571477(97.44%)  34268444(10+bp ovl F/R)
 chr14_shortjump_12.fastq    22669408   11255320(49.64%)  11255320
 chr14_longjump_12.fastq     2405064    187398   (7.79%)  187398
  • Assembly stats:
 .          elem  min    q1     q2     q3      max       mean     n50       sum       
 scf        418   96     131    256    1236    81646936  209781   81646936  87688255  
 scf10K+    17    10330  11780  26536  269876  81646936  5135452  81646936  87302692  
 ctg        4722  96     2342   9101   24174   240773    17887    36530       84461065
  • Runtime 1104299.893u 126549.756s 18:50:05.80 1815.2% 0+0k 0+0io 8463pf+0w
 18hr 50min :                   multiprocessor
 1104299/(3600*24)=12.78 days : singleprocessor

Argentine ant

Data

          #reads        readLen   readCvg
 Shotgun: 39,741,216    75        12
 3kb:     46,435,880    75        13  
 8kb:     43,839,748    75        13
 Total:   130,016,844   75        40
  • Location
 /fs/szattic-asmg7/argentine_ant/Illumina/

UC Assemblaton1

 chr0_1         76252953
 chr0_2         76285600
 chr1_1         18509915
 chr1_2         18539192
 chr2_1         17699484
 chr2_2         17710169

UC Assemblaton1

...

Retrieved from "https://wiki.umiacs.umd.edu/cbcb/index.php?title=Dpuiu_Assemblathon&oldid=8837"