Dpuiu Assemblathon: Difference between revisions

From Cbcb
Jump to navigation Jump to search
 
(10 intermediate revisions by the same user not shown)
Line 22: Line 22:
   echo frag_1.fastq      frag_2.fastq      >  genome.ls
   echo frag_1.fastq      frag_2.fastq      >  genome.ls
   echo shortjump_1.fastq shortjump_2.fastq >> genome.ls
   echo shortjump_1.fastq shortjump_2.fastq >> genome.ls
  echo longjump_1.fastq  longjump_2.fastq  >> genome.ls
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/quake.py -f genome.ls  -k 18 -p 20 >&! quake.log
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/quake.py -f genome.ls  -k 18 -p 20 >&! quake.log


= Assemblers =
= Assemblers =


* [http://www.broadinstitute.org/software/allpaths-lg/blog/ Allpaths-LG ]  /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/allpaths3-35218/
* [http://www.broadinstitute.org/software/allpaths-lg/blog/ Allpaths-LG ]   
  /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/RunAllPaths3G PRE=$PWD REFERENCE_NAME=. DATA_SUBDIR=. RUN=allpaths SUBDIR=run1.orig THREADS=24
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/allpaths3-35218/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 
  RunAllPaths3G \
    PRE=$PWD REFERENCE_NAME=. DATA_SUBDIR=. RUN=allpaths SUBDIR=run1.orig THREADS=$P
 
* [http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=Main_Page CA]           
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 
  runCA \
    -d . \
    -p asm \
    -s /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/runCA.parallel.spec \
    doOverlapBasedTrimming=0 ovlOverlapper=ovl unitigger=bog bogBreakAtIntersections=0 bogBadMateDepth=1000 \
    *.frg
 
* [http://www.ebi.ac.uk/~zerbino/velvet/ Velvet]       
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/velvet_1.0.13/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 
  velveth . $K -fastq \
    -shortPaired  frag_12.fastq \
    -shortPaired2 shortjump_12.rev.fastq \
    -shortPaired3 longjump_12.fastq
  velvetg . -exp_cov auto
    -ins_length  $MEA_FRAG      -ins_length_sd  $STD_FRAG \
    -ins_length2 $MEA_SHORTJUMP -ins_length2_sd $STD_SHORTJUMP \
    -ins_length3 $MEA_LONGJUMP  -ins_length3_sd $STD_LONGJUMP \
    -scaffolding yes -exportFiltered yes -unused_reads yes


* [http://sourceforge.net/apps/mediawiki/wgs-assembler/index.php?title=Main_Page CA]             /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/
* [http://soap.genomics.org.cn/soapdenovo.html SOAPdenovo]    
* [http://www.ebi.ac.uk/~zerbino/velvet/ Velvet]        /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/velvet_1.0.13/
  paths:
* [http://soap.genomics.org.cn/soapdenovo.html SOAPdenovo]    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SOAPdenovo-V1.05/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SOAPdenovo-V1.05/
* MSR-CA         Maryland Super-Reads + Celera Assembler.
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
* [http://www.bcgsc.ca/platform/bioinfo/software/abyss ABYSS]          /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/abyss-1.2.7/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/GapCloser/
* [https://github.com/jts/sga/wiki SGA]            /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/sga/src/SGA/                      # Version: 0.9.8
 
  echo "[LIB]\navg_ins=$MEA_FRAG\nreverse_seq=0\nasm_flags=1\nrank=1\nq1=frag_1.fastq\nq2=frag_2.fastq\n" >! SOAPdenovo.config
  echo "[LIB]\navg_ins=$MEA_SHORTJUMP\nreverse_seq=1\nasm_flags=2\nrank=2\nq1=shortjump_1.fastq\nq2=shortjump_2.fastq\n" >> SOAPdenovo.config
  echo "[LIB]\navg_ins=$MEA_LONGJUMP\nreverse_seq=0\nasm_flags=2\nrank=4\nq1=longjump_1.fastq\nq2=longjump_2.fastq\n" >> SOAPdenovo.config
  SOAPdenovo all -K $K -p $P -s ./SOAPdenovo.config -o asm
  GapCloser -b SOAPdenovo.config -a asm.scafSeq -o asm2.scafSeq -t $P -p 31
 
* [http://www.genome.umd.edu/SR_CA_MANUAL.htm MSR-CA        Maryland Super-Reads + Celera Assembler.]
  paths:
     /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SR-CA-1.1/CA/Linux-amd64/bin/
* [http://www.bcgsc.ca/platform/bioinfo/software/abyss ABYSS]           
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/abyss-1.2.7/
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin
 
  abyss-pe  \
    k=$K n=5 name=asm lib='frag short' frag=frag_12.fastq short=short_12.fastq aligner=bowtie
 
* [https://github.com/jts/sga/wiki SGA]             
  paths:
    /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/sga/src/SGA/                      # Version: 0.9.8
    /fs/szdevel/core-cbcb-software/Linux-x86_64/bin
 
  sga preprocess -p 1 frag_?.fastq > frag.pp.fa
  sga index -t $P frag.pp.fa
  sga correct -k $K -t $P frag.pp.fa -o frag.pp.ec.fa 
  sga index -t $K frag.pp.ec.fa
  sga filter frag.pp.ec.fa
  sga overlap -t $P frag.pp.ec.filter.pass.fa
  sga assemble frag.pp.ec.filter.pass.asqg.gz


= CBCB genomes =
= CBCB genomes =
Line 112: Line 182:
  CA.quakeCor                /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/                              # Celera Assembly
  CA.quakeCor                /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/                              # Celera Assembly
   
   
SOAPdenovo.orig(K=47)      /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.orig/                        # SOAPdenovo assembly (2011) K=47 original reads 
SOAPdenovo.quakeCor(K=31)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/                            # SOAPdenovo assembly (2010) K=31 quake corrected reads (prev assembler version)
  SOAPdenovo.quakeCor(K=47)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.cor/                        # SOAPdenovo assembly (2011) K=47 quake corrected reads
  SOAPdenovo.quakeCor(K=47)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.cor/                        # SOAPdenovo assembly (2011) K=47 quake corrected reads
#SOAPdenovo.orig(K=47)      /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.orig/                      # SOAPdenovo assembly (2011) K=47 original reads 
#SOAPdenovo.quakeCor(K=31)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/                            # SOAPdenovo assembly (2010) K=31 quake corrected reads (prev assembler version)
MSR-CA                    /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/MSR-CA  ; genome9.umd.edu:/genome9/raid/alekseyz/GAGE/bombus/assembly/CA      # MSR-CA


== Staph aureus USA300 ==
== Staph aureus USA300 ==

Latest revision as of 17:07, 1 August 2011

Links

  • The Assemblathon University of California, Santa Cruz & UC Davis; synthetic & real genome.
  • dnGASP De Novo Genome Assembly Assessment Project (dnGASP): Centro Nacional de Análisis Genómico in Barcelona, Spain, synthetic genome
  • GAGE
  • genomeweb announcement

GAGE

  • Location
 http://gage.cbcb.umd.edu/ -> /fs/web-cbcb-new/html/gage
  • Answer following questions:
  1. How much sequencing coverage do I need for my genome project?
  2. What can I expect the resulting assembly to look like?
  3. Which assembly software should I use?
  4. What parameters should I use when I run the software?

Read correction

  • quake
 echo frag_1.fastq      frag_2.fastq      >  genome.ls
 echo shortjump_1.fastq shortjump_2.fastq >> genome.ls
 echo longjump_1.fastq  longjump_2.fastq  >> genome.ls 

 /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/quake.py -f genome.ls  -k 18 -p 20 >&! quake.log

Assemblers

 paths: 
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/allpaths3-35218/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 RunAllPaths3G \
    PRE=$PWD REFERENCE_NAME=. DATA_SUBDIR=. RUN=allpaths SUBDIR=run1.orig THREADS=$P
 paths: 
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/wgs-6.1/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 runCA \
    -d . \
    -p asm \
    -s /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/runCA.parallel.spec \
    doOverlapBasedTrimming=0 ovlOverlapper=ovl unitigger=bog bogBreakAtIntersections=0 bogBadMateDepth=1000 \
    *.frg
 paths: 
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/velvet_1.0.13/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
 velveth . $K -fastq \ 
   -shortPaired  frag_12.fastq \
   -shortPaired2 shortjump_12.rev.fastq \
   -shortPaired3 longjump_12.fastq

 velvetg . -exp_cov auto 
   -ins_length  $MEA_FRAG      -ins_length_sd  $STD_FRAG \
   -ins_length2 $MEA_SHORTJUMP -ins_length2_sd $STD_SHORTJUMP \
   -ins_length3 $MEA_LONGJUMP  -ins_length3_sd $STD_LONGJUMP \
   -scaffolding yes -exportFiltered yes -unused_reads yes
 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SOAPdenovo-V1.05/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/GapCloser/
 echo "[LIB]\navg_ins=$MEA_FRAG\nreverse_seq=0\nasm_flags=1\nrank=1\nq1=frag_1.fastq\nq2=frag_2.fastq\n" >! SOAPdenovo.config
 echo "[LIB]\navg_ins=$MEA_SHORTJUMP\nreverse_seq=1\nasm_flags=2\nrank=2\nq1=shortjump_1.fastq\nq2=shortjump_2.fastq\n" >> SOAPdenovo.config
 echo "[LIB]\navg_ins=$MEA_LONGJUMP\nreverse_seq=0\nasm_flags=2\nrank=4\nq1=longjump_1.fastq\nq2=longjump_2.fastq\n" >> SOAPdenovo.config

 SOAPdenovo all -K $K -p $P -s ./SOAPdenovo.config -o asm

 GapCloser -b SOAPdenovo.config -a asm.scafSeq -o asm2.scafSeq -t $P -p 31
 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/SR-CA-1.1/CA/Linux-amd64/bin/

 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/abyss-1.2.7/
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin
 abyss-pe  \
   k=$K n=5 name=asm lib='frag short' frag=frag_12.fastq short=short_12.fastq aligner=bowtie
 paths:
   /fs/szdevel/core-cbcb-software/Linux-x86_64/packages/sga/src/SGA/                      # Version: 0.9.8
   /fs/szdevel/core-cbcb-software/Linux-x86_64/bin
 sga preprocess -p 1 frag_?.fastq > frag.pp.fa 
 sga index -t $P frag.pp.fa 

 sga correct -k $K -t $P frag.pp.fa -o frag.pp.ec.fa  
 sga index -t $K frag.pp.ec.fa 

 sga filter frag.pp.ec.fa 
 sga overlap -t $P frag.pp.ec.filter.pass.fa

 sga assemble frag.pp.ec.filter.pass.asqg.gz

CBCB genomes

  • a bacterial genome. Instead of E. coli, we can use S. aureus USA300, which has sequence data in SRA from 454 and Illumina, paired and unpaired. Daniela has already assemblied it using CA, Newbler, Velvet, SOAPdenovo, and Maq (using its comparative assembly mode, where it aligns to a reference).
  • A medium-sized eukaryote. I'd like to use the Argentine ant or the Bombus impatiens bee - I've just written to Gene Robinson to ask about the bee.
  • Another eukaryote, ideally a larger one. Human would be great, but we just don't have enough time to do multiple human assemblies. So maybe another insect, or perhaps a plant if we can find one for which data is available.

If we can agree on the data sets, then the next step would be to design the experiment - decide in advance which assemblers to run and how many ways to try each one. I'm thinking we should also trim all the data with Quake.

Bombus impatiens

Data

  • Estimated haploid genome size: 250M
  • 497,318,144 Illumina 124bp reads (246X cvg)
  • Reads:
 .        readLen  orientation  insLen  #reads       readCvg  comments   
 frag     124      innie        400     303,118,594  150X     6 libs 
 short    124      outie        3-8K    194,199,550  96X      2 libs
  • Issue: Adapters: in 3k & 8k libraries
C CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
3 CGGCATTCCTGCTGAACCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5 GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
  • Read directories:
/fs/szattic-asmg4/Bees/Bombus_impatiens/s_[12356789]_[12]_sequence.txt                             # original fastq files

/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[129]_[012]_sequence.cor.rev.txt        # adaptor free corrected reads (long inserts)
/fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_[35678]_[012]_sequence.cor.txt          # corrected reads (short inserts)
  • Original read files:
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_1_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_1_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_2_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_2_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_3_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_3_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_5_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_5_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_6_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_6_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_7_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_7_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_8_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_8_2_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_9_1_sequence.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/s_9_2_sequence.txt  
  • Quake corrected files:
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_1_1_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_1_2_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_2_1_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_2_2_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_3_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_3_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_5_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_5_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_6_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_6_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_7_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_7_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_8_1_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_8_2_sequence.cor.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_9_1_sequence.cor.rev.txt  
 /fs/szattic-asmg4/Bees/Bombus_impatiens/error_free/fastq/s_9_2_sequence.cor.rev.txt
  • k_unitig corrected files: (in progress --Dpuiu 10:38, 5 April 2011 (EDT))

Assembly

CA.quakeCor                /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/CA.s_1-8.cor.redo2/                               # Celera Assembly

SOAPdenovo.quakeCor(K=47)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.cor/                         # SOAPdenovo assembly (2011) K=47 quake corrected reads
#SOAPdenovo.orig(K=47)      /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.K47.s_1-9.orig/                       # SOAPdenovo assembly (2011) K=47 original reads   
#SOAPdenovo.quakeCor(K=31)  /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/SOAPdenovo.s_1-9.cor/                            # SOAPdenovo assembly (2010) K=31 quake corrected reads (prev assembler version)

MSR-CA                     /fs/szattic-asmg5/Bees/Bombus_impatiens/Assembly/MSR-CA  ; genome9.umd.edu:/genome9/raid/alekseyz/GAGE/bombus/assembly/CA       # MSR-CA

Staph aureus USA300

Data

  • Complete genome:
 id             len     description
 NC_010079      2872915 Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome
 NC_010063.1    27041   Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence
 NC_012417.1    3125    Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA01-HOU, complete sequence
                2903081 total 
  • Reads (90X):
 .            readLen  insLen  orientation     #reads     readCvg      SRA runs
 frag         101      180     innie           1,294,104  45X          SRR022868 
 shortjump    37       3500    outie           3,494,070  45X          SRR022865 
 SRP001086 Staphylococcus aureus Sequencing on Illumina
 SRX007714 pair lib
 SRX007711 jumping lib
  • Read directories:
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/
  • Original read files:
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/frag_1.fastq  
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminap100/frag_2.fastq  
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/short_1.fastq  
 /nfshomes/dpuiu/HTS/Staphylococcus_aureus/Data/Illuminaj/short_2.fastq  
  • Quake corrected files:
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/frag_1.cor.fastq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/frag_2.cor.fastq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/short_1.cor.fastq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/quake/short_2.cor.fastq
  • Allpaths-LG corrected files:
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/frag_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/frag_2.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/short_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpathsCor/short_2.cor.fasta  
  • k_unitig corrected files:
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/frag_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/frag_2.cor.seq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/short_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Staphylococcus_aureus/Illumina.180_45X.3500_45X/k_unitig/short_2.cor.seq

Assembly

 allpaths.orig                     /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/allpaths

 CA.orig                           /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.orig
 CA.quakeCor                       /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.quakeCor.k18
 CA.allpathsCor                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.allpathsCor
 CA.SuperReads                     /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/CA.SuperReads.latest

 SOAPdenovo.orig(K=31)             /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.orig
 SOAPdenovo.orig(K=47)             /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.orig
 SOAPdenovo.quakeCor(K=31)         /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.quakeCor.k18
 SOAPdenovo.quakeCor(K=47)         /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.quakeCor.k18
 SOAPdenovo.allpathsCor(K=31)      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K31.allpathsCor
 SOAPdenovo.allpathsCor(K=47)      /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SOAPdenovo.K47.allpathsCor

 velvet.orig                       /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.orig
 velvet.quakeCor                   /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.quakeCor.k18 
 velvet.allpathsCor                /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/velvet.allpathsCor
 
 ABYSS.quakeCor                    /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/ABYSS.K31.quakeCor.k18
 SGA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Staphylococcus_aureus/Illumina.180_45X.3500_45X/SGA.orig
  • SOAPdenovo v1.05 :
    • new quake version did not help much (quake-0.2.2 vs davek44-error_correction-28dbe11)
    • SOAPdenovo map -K 37+ : fails on quakeCor.k18 corrected reads
    • "according" to kmerFreq , should probably not use -K >47
    • longer kmer => longer scaffolds (K=63 : largest N50scf)
    • longer kmer => shorted contigs (K=31 : largest N50ctg)
    • K40+ too large: no "valley" in the kmerFreq histogram
 paste SOAPdenovo.K??.quakeCor.k18/genome.K??.kmerFreq | nl0 | head
 paste SOAPdenovo.K??.allpathsCor/genome.K??.kmerFreq | nl0 | more

Rhodobacter sphaeroides

Data

  • Complete genome: 2 chromosomes, 5 plasmids
 id             len     description
 CP000143       3188609 Rhodobacter sphaeroides 2.4.1 chromosome 1, complete sequence.
 CP000144       943016  Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence.
 DQ232586       114045  Rhodobacter sphaeroides 2.4.1 plasmid A, partial sequence.
 CP000145       114178  Rhodobacter sphaeroides 2.4.1 plasmid B, complete sequence.
 CP000146       105284  Rhodobacter sphaeroides 2.4.1 plasmid C, complete sequence.
 CP000147       100828  Rhodobacter sphaeroides 2.4.1 plasmid D, complete sequence.
 DQ232587       37100   Rhodobacter sphaeroides 2.4.1 plasmid E, partial sequence.
                4603060 total 
  • Reads (90X):
 .            readLen  insLen  orientation     #reads     readCvg      SRA runs  
 frag         101      180     innie           2,050,868  45X          SRR081522 
 shortjump    101      3500    outie           2,050,868  45X          SRR034528 
  • SRA traces
 SRX033397 pair lib ;    readLen=101 ; insMea=180 
 SRX016063 jumping lib ; readLen=101 ; insMea~=3455; ~15% of the mates are short inserts (~250bp)
  • Original read files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminap/frag_1.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminap/frag_2.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminaj/short_1.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Data/Illuminaj/short_2.fastq  
  • Quake corrected read files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/frag_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/frag_2.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/short_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/short_2.cor.fastq  
  • QuakeIter2 corrected read files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/frag_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/frag_2.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/short_1.cor.fastq  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/quake/iter2_dk/short_2.cor.fastq  
  • Allpaths-LG corrected files:
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/frag_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/frag_2.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/short_1.cor.fasta  
 /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpathsCor/short_2.cor.fasta  
  • k_unitig corrected files:
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/frag_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/frag_2.cor.seq  
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/short_1.cor.seq  
 /nfshomes/dpuiu/GAGE/Rhodobacter_sphaeroides//Illumina.180_45X.3500_45X/k_unitig/short_2.cor.seq

Assembly

  • Assembly directories:
 allpaths.orig                    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/allpaths
 
 CA.orig                          /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.orig
 CA.quakeCor                      /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.quakeCor.k18
 CA.allpathsCor                   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.allpathsCor

 CA.SuperReads                    /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/CA.SuperReads.latest

 SOAPdenovo.orig(K=31)            /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.orig/K31
 SOAPdenovo.orig(K=47)            /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.orig
 SOAPdenovo.quakeCor(K=31)        /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.quakeCor.k18/K31
 SOAPdenovo.quakeCor(K=47)        /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.quakeCor.k18
 SOAPdenovo.allpathsCor(K=31)     /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.allpathsCor/K31
 SOAPdenovo.allpathsCor(K=47)     /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SOAPdenovo.allpathsCor

 velvet.orig                      /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.orig
 velvet.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.quakeCor
 velvet.allpathsCor               /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/velvet.allpathsCor

 ABYSS.quakeCor                   /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/ABYSS.K31.quakeCor.k18
 
 SGA.orig                         /fs/szattic-asmg5/dpuiu/HTS/Rhodobacter_sphaeroides/Illumina.180_45X.3500_45X/SGA.quakeCor.k18

Human, a single chromosome, medium-sized

Data

  • Latest online assembly
 ftp://ftp.ncbi.nih.gov/genomes/H_sapiens/Assembled_chromosomes/seq/
  NC_000014.8    107,349,540  # total, with telomeric N's 
                  88,289,540  # clean
  • Human bowtie indexes
  /fs/szdata/bowtie_indexes/h_sapiens_37_asm
  • Chr14 filtered reads (69.3X):
 .            readLen  insLen        orientation    #reads        readCvg        
 frag         101      155           innie          36,504,800    42
 shortjump    101      2283-2803     outie          22,669,408    26
 longjump     76-101   35295-35318   innie          2,405,064     1.3
  • Illumina reads (all genome)
 Human NA12878 Genome on Illumina 
 ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra-instant/reads/ByStudy/litesra/SRP/SRP003/SRP003680/
 ginko:/scratch1/Human_NA12878_on_Illumina/
 #Fragment (mean insert size: 155bp, SD 26), 101 bp read length
 Lib          #Spots  #Bases  #Reads     #Mates     ReadLen  InsMea  InStd  InsMin  InsMax   TrimReadLen    Comments
 SRR067787    82.4M   16.6G   652448124  324283604  101      155     26     77      458                     Human HapMap individual NA12878 HiSeq 2000
 SRR067789    82.6M   16.7G   654133372  324876520  101      155     26     77      458     
 SRR067780    83.3M   16.8G   660001672  328021140  101      155     26     77      458     
 SRR067791    83.0M   16.8G   657963460  327205952  101      155     26     77      458     
 SRR067793    77.0M   15.5G   609634756  303094956  101      155     26     77      458     
 SRR067784    83.3M   16.8G   660118460  328244560  101      155     26     77      458     
 SRR067785    81.6M   16.5G   646350512  321174108  101      155     26     77      458     
 SRR067792    83.8M   16.9G   663997828  330084304  101      155     26     77      458                      

 SRR067577    46.3M   9.3G    367673108  183472948  101      155     26     77      458                      Human HapMap individual NA12878 Illumina GAII
 SRR067579    46.0M   9.3G    365743380  182532676  101      155     26     77      458     
 SRR067578    46.5M   9.4G    369557476  184410788  101      155     26     77      458     
 
 #Jumping1 (mean insert size: 2283bp, SD 221), 101 bp read length
 SRR067771    81.5M   16.5G   644846296  320822716  101      2283    221    1620    2586                     Human HapMap individual NA12878 HiSeq 2000
 SRR067777    82.6M   16.7G   653163608  325232944  101      2283    221    1620    2586    
 SRR067781    82.1M   16.6G   649748720  323656576  101      2283    221    1620    2586    
 SRR067776    79.9M   16.1G   632590344  315165892  101      2283    221    1620    2586    
 
 #Jumping2 (mean insert size: 2803bp, SD 271), 101 bp read length
 SRR067773    93.1M   18.8G   736456192  366884512  101      2803    271    1990    3106                      Human HapMap individual NA12878 HiSeq 2000
 SRR067779    94.0M   19.0G   743564440  370214028  101      2803    271    1990    3106    
 SRR067778    97.3M   19.6G   767984324  381879652  101      2803    271    1990    3106    
 SRR067786    94.6M   19.1G   747631104  372002548  101      2803    271    1990    3106    
 
 #Fosmid1  (mean insert size: 35295bp, SD 2703), 76 bp read length
 SRR068214    13.1M   2.0G    104505420  52087176   76       35295   2703   27186   35523   36(trim 20bp at 5',20bp at 3')       Human HapMap individual NA12878 Illumina GAII
 SRR068211    4.8M    736.9M  38612196   19252408   76       35295   2703   27186   35523   36(trim 20bp at 5',20bp at 3')       Human HapMap individual NA12878 Illumina GAII
 
 #Fosmid2 (mean insert size: 35318bp, SD 2759),  101 bp read length
 SRR068335    67.4M   13.6G   533805860  265481252  101      35318   2759   27041   35621   61(trim 20bp at 5',20bp at 3')       Human HapMap individual NA12878 HiSeq 2000
  • Comments
    • Human chromosome 14. The chromosome may change, but this is a new data set with 100X coverage in 100bp and 76bp reads, just assembled by the Broad group using Allpaths-LG and Soap. We've downloaded the data and Todd is going to create a data set representing just chr 14, to make it feasible. We'll then try to assemble that data w/all 3 assemblers: CA, SOAP, Allpaths-LG.
  • Illumina chr14 reads (aligned with bowtie & corrected)
 /fs/szattic-asmg8/treangen/*fastq
 hard to align: bowtie -5 20 -3 20 -e 1000 ...
 jumping reads: only the ones aligned within coorect mean, stdev selected; these libraries usually have a high % of short inserts!!!
  • Original read files:
 /fs/szattic-asmg8/treangen/chr14_fragment_1.fastq  
 /fs/szattic-asmg8/treangen/chr14_fragment_2.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_1.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_2.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_1.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_2.fastq  
  • Quake corrected files:
 /fs/szattic-asmg8/treangen/chr14_fragment_1.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_fragment_2.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_1.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_shortjump_2.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_1.cor.fastq  
 /fs/szattic-asmg8/treangen/chr14_longjump_2.cor.fastq  
  • Allpaths-LG corrected files:
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_fragment_1.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_fragment_2.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_shortjump_1.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_shortjump_2.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_longjump_1.cor.fasta
 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpathsCor/chr14_longjump_2.cor.fasta

Assembly

  • Assembly directories
 allpaths                         /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/allpaths

 CA.allpathsCor                   /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/CA.allpathsCor , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/CA.allpathsCor               
 CA.quakeCor                      /fs/szattic-asmg8/tmagoc/GAGE/human
 CA.SuperReads                    ginkgo:/scratch1/dpuiu/HTS/Homo_sapiens/Assembly/CA.SuperReads

 SOAPdenovo.orig(K=47)           /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.orig/ 
 SOAPdenovo.quakeCor(K=31)       /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/K31    , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/K31
 SOAPdenovo.quakeCor(K=47)       /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor/       , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.quakeCor 
 SOAPdenovo.allpathsCor(K=31)    /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor/K31 , /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor/K31
 SOAPdenovo.allpathsCor(K=47)    /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor ,     /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SOAPdenovo.allpathsCor

 velvet.quakeCor                 /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/velvet.quakeCor

 ABYSS.quakeCor                  /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/ABYSS.K31.quakeCor.K18  ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/ABYSS.K31.quakeCor.K18

 SGA.orig                        /fs/szattic-asmg5/dpuiu/HTS/Homo_sapiens/Assembly/SGA.orig                ,    /scratch1/dpuiu/HTS/Homo_sapiens/Assembly/SGA.orig

Allpaths-lg

  • Read counts
                             orig       cor               cor(paired,all >64bp)
 chr14_fragment_12.fastq     36504800   35571477(97.44%)  34268444(10+bp ovl F/R)
 chr14_shortjump_12.fastq    22669408   11255320(49.64%)  11255320
 chr14_longjump_12.fastq     2405064    187398   (7.79%)  187398  
  • Assembly stats:
 .          elem  min    q1     q2     q3      max       mean     n50       sum       
 scf        418   96     131    256    1236    81646936  209781   81646936  87688255  
 scf10K+    17    10330  11780  26536  269876  81646936  5135452  81646936  87302692  
 ctg        4722  96     2342   9101   24174   240773    17887    36530       84461065  
  • Runtime 1104299.893u 126549.756s 18:50:05.80 1815.2% 0+0k 0+0io 8463pf+0w
 18hr 50min :                   multiprocessor
 1104299/(3600*24)=12.78 days : singleprocessor

Argentine ant

Data

          #reads        readLen   readCvg
 Shotgun: 39,741,216    75        12
 3kb:     46,435,880    75        13  
 8kb:     43,839,748    75        13
 Total:   130,016,844   75        40
  • Location
 /fs/szattic-asmg7/argentine_ant/Illumina/

UC Assemblaton1

 chr0_1         76252953
 chr0_2         76285600
 chr1_1         18509915
 chr1_2         18539192
 chr2_1         17699484
 chr2_2         17710169

UC Assemblaton1

...