NCBI submission: Difference between revisions
Jump to navigation
Jump to search
Email
(→AA) |
|||
Line 300: | Line 300: | ||
$ cd assembly | $ cd assembly | ||
$ put *.tar.gz | $ put *.tar.gz | ||
= dbGSS = | |||
* 4 files: | |||
1. Publication | |||
TYPE: Pub #required | |||
MEDUID: 92347897 | |||
TITLE: #required | |||
Genomic sequences from a subtracted retinal pigment epithelium | |||
library | |||
AUTHORS: #required | |||
Gieser,L.; Swaroop,A. | |||
JOURNAL: Genomics | |||
VOLUME: 13 | |||
ISSUE: 2 | |||
PAGES: 873-6 | |||
YEAR: 1992 #required | |||
STATUS: 4 #required :1=unpublished, 2=submitted, 3=in press, 4=published | |||
|| | |||
2. Library | |||
TYPE: Lib #required | |||
NAME: Rat Lambda Zap Express Library | |||
ORGANISM: Rattus norvegicus | |||
STRAIN: Sprague-Dawley | |||
SEX: male | |||
STAGE: embryonic day 17 post-fertilization | |||
TISSUE: aorta | |||
CELL_TYPE: vascular smooth muscle | |||
DESCR: | |||
Put description here. | |||
|| | |||
3. Contact | |||
TYPE: Cont | |||
NAME: Sikela JM | |||
FAX: 303 270 7097 | |||
TEL: 303 270 | |||
EMAIL: tjs@tally.hsc.colorado.edu | |||
LAB: Department of Pharmacology | |||
INST: University of Colorado Health Sciences Center | |||
ADDR: Box C236, 4200 E. 9th Ave., Denver, CO 80262-0236, USA | |||
|| | |||
4. GSS sequence file | |||
TYPE: GSS | |||
STATUS: New | |||
CONT_NAME: Sikela JM | |||
GSS#: Ayh00001 | |||
CLONE: HHC189 | |||
SOURCE: ATCC | |||
SOURCE_INHOST: 65128 | |||
OTHER_GSS: GSS00093, GSS000101 | |||
CITATION: | |||
Genomic sequences from Human | |||
brain tissue | |||
SEQ_PRIMER: M13 Forward | |||
P_END: 5' | |||
HIQUAL_START: 1 | |||
HIQUAL_STOP: 285 | |||
DNA_TYPE: Genomic | |||
CLASS: shotgun | |||
LIBRARY: Hippocampus, Stratagene (cat. #936205) | |||
PUBLIC: | |||
PUT_ID: Actin, gamma, skeletal | |||
COMMENT: | |||
SEQUENCE: | |||
AATCAGCCTGCAAGCAAAAGATAGGAATATTCACCTACAGTGGGCACCTCCTTAAGAAGCTG | |||
... | |||
|| |
Revision as of 16:49, 20 May 2011
WGS/TPA
Links
- Info
- wgs
- tbl2asn
- Sequence modifiers
- AGP format
- Bacterial Genomes
- Annotation Annotation Info ,Locus tag extra info
Registration
- Register WGS form
- CBCB Genome Projects:
* search Genome Project for Center for Bioinformatics and Computational Biology[Sequencing Center] * Xanthomonas oryzae pv. oryzae PXO99A complete; /fs/szdata/ncbi/ftp.ncbi.nih.gov/genomes/Bacteria/Xanthomonas_oryzae_PXO99A * Xanthomonas oryzae pv. oryzicola BLS256 assembly
Output:
- genome project id (5 digit); use it in e-mail correspondence
- locus_tags (3+ letter/digit)
- Locus tag database to check if the chosen locus tag is available
Requirements
- ctg's: no gaps; .sqn format
- annotation: either for ctg's or superctg's ; .sqn format
- suprectg's: AGP format
Output:
- 4-letter WGS project_ID : XXXX
- project accession number : XXXX00000000 (4-letter ID followed by 8 0's)
- 1st version: XXXX01000000
- 1st version ctg's: XXXX01000001
- CON record for suprectg's
Formating
Metadata
- .sbt file gebnerated by Sequin
- SeqIn
- QuickGuide
- multiple sequences
/nfshomes/dpuiu/szdevel/sequin.8.10/sequin /nfshomes/dpuiu/szdevel/bin/sequin # latest version !!! import /nfshomes/dpuiu/bin/seqin.sqn
Form Submission: Immediately ... Tentative manuscript title: Contact: Name: Daniela Puiu Phone: 301.405.3403 Fax: 301.314.1341 Email: dpuiu@umiacs.umd.edu Authors: Daniela Puiu Steven L. Salzberg ... Affiliation Institution: University of Maryland, Center for Bioinformatics and Computational Biology , 3115 Biomolecular Sciences Building #296, College Park, MD 20742 , US
Seqeuence format Batch submission FASTA Original submission ... Organism and Sequences: Nucleotide: can import from FASTA file Organism: strain, moltype Proteins Annotation
Export template => /nfshomes/dpuiu/bin/sequin.sbt : contains submission info
Tags
$ addFastaTags.pl -s " [organism=...] [strain=wPip] [substrain=JBH] [tech=wgs]" prefix.fasta
Annotation
- Generating the .tbl format from a TAB delinited format
$ ~dpuiu/bin/tab2annotation.pl -h # Example: tab2annotation.pl -ht "SeqId Location Strand Length Product" prefix.ptt > prefix.tbl tab2annotation.pl -hl 1 -SeqId NC_012456 prefix.ptt > prefix.tbl # INPUT SeqId SeqIdLength OrfId Start End Length Product 1225 2425 002 422 706 285 malate synthase G # OUTPUT >Feature 1225 422 706 gene locus_tag C1A_1225_002 422 706 CDS product malate synthase G protein_id gnl|cbcb|C1A_1225_002
Merge
- tbl2asn: command line
- tbl2asn man
Input files: prefix.sbt: submission file prefix.fsa: sequence : at most 10,000 sequences/file prefix.tbl: annotation $ tbl2asn -t prefix.sbt -V v -s -p . $ tbl2asn -t prefix.sbt -V v -s -i prefix.fasta
$ tbl2asn -t template.sbt -i prefix.fasta -V v -s
- Input files: sequin.sbt
* template (*.sbt) Example: /nfshomes/dpuiu/bin/sequin.sbt comment : is the article name
* FASTA sequence (*.fsa) >SeqID [organism=...] [strain=...] [tech=wgs] [chromosome=...][gcode=11] Adding tags: ~dpuiu/bin/addFastaTags.pl -s " [organism=...] [strain=wPip] [substrain=JBH] [tech=wgs]" wPipJBH.fasta
* annotation table (*.tbl) (optional) 5-column table locus_tag for genes protein_id for proteins product for proteins
- Output files:
* ASN.1 (*.sqn) for submission to GenBank. * .val: validation file; check it for errors
AGP
- AGP_Specification.shtml
- Sequence gaps : "fragment yes"
- Scaffold gaps : "contig no"
$ scaff2agp.pl < prefix.scaff > prefix.agp $ infoseq2agp.pl prefix.infoseq > prefix.agp $ valiadteAgp.pl prefix.agp
Submission
BankIt
- BankIt
- one or a few sequence submissions
- e-mail the output file to gb_sub@ncbi.nlm.nih.gov (deprecated)
GenomeMacroSend
- GenomeMacroSend : submit *.sqn, *.tbl, *.fsa, *agp files
Ftp
- for large WGS projects
server: ftp-trace.ncbi.nlm.nih.gov login: cbcb_trc password: t@@GeaYF center: CBCB directory: test/ ; don't use uploads/ that is used by SRA
Updates
- Updating
- in .sbt file replace "subtype new" with "subtype update"
TA
Compressed archive containing 3 files: TRACEINFO.xml, MD5, README traces/ directory SCF format traces under traces/ or traces/*/ The archive(s) is/are gzip files 1-4GB; include center's name and the date into file names Accepted only by uploading to NCBI FTP server. server: ftp-trace.ncbi.nih.gov login: passwd: center: UMD
Scripts:
/nfshomes/dpuiu/Archives/JCVI/bin/phred2xmlTrace.pl
Genbank & SRA
server: ftp-trace.ncbi.nlm.nih.gov login: cbcb_trc password: t@@GeaYF Center_name (acronym): CBCB Full name: Center for Bioinformatics and Computational Biology, University of Maryland Directory (Short reads): short_read/ Directory (Sanger reads): uploads/ Directory (test): test/ (Assembled sequences) Validation table
AA
- !!! Need a TaxId before formatting the files
- AA
- AA submission info
Compressed archive containing 2 files: ASSEMBLY.xml , MD5 Accepted only by uploading to NCBI FTP server. server: ftp-private.ncbi.nlm.nih.gov login: cbcb_trc passwd: t@@GeaYF center: UMD description: University of Maryland ASSEMBLY XML Schema png ASSEMBLY XML Schema xsd
Use XContig package scripts
Files:
.contig : contigs & underlying reads (use TRACE_NAME's or SEQ_NAME's) .seq : read sequences (use TRACE_NAME's or SEQ_NAME's) .qual : read qualities (use TRACE_NAME's or SEQ_NAME's) .ti2seq_name : (TI , TRACE_NAME or SEQ_NAME) : required if the contig file soes not use the read ti's
$ bank2contig -e prefix.bnk > prefix.contig $ dumpreads -e -r prefix.bnk > prefix.seq $ dumpreads -e -r -q prefix.bnk > prefix.qual
Example:
Xoo: /fs/szasmg/Bacteria/Xanthomonas/XOO/Xoo_PXO99A/FinalAsm_June2007/AA
Steps:
1. makeConinfo ASSEMBLY.coninfo $ more ASSEMBLY.coninfo <coninfo> <meta name='center'>UMD</meta> <meta name='db'>Xoo</meta> <meta name='desc'>Xanthomonas oryzae pv. oryzae strain PXO99A</meta> <meta name='object'>ASSEMBLY</meta> <meta name='species_code'>Xanthomonas oryzae pv. oryzae strain PXO99A</meta> <meta name='structure'>Chromosome</meta> <meta name='subtype'>NEW</meta> <meta name='taxid'>360094</meta> <contig id="1106158952778_stitched" conformation="CIRCULAR" subtype="NEW"/> <contig id="... "/> <file src="Xoo.contig"/> <seq src="Xoo.seq"/> <qual src="Xoo.qual"/> <idmap src="Xoo.ti2seq_name" direction="FORWARD"/> </coninfo>
2. buildAssemblyArchive ASSEMBLY.coninfo --prompt --subname umd-20070816-125223 problems: * submitter_reference="tigr...." : replace tigr with umd * conformation: always LINEAR : replace LINEAR with CIRCULAR ???
3. validate: oXygen: software used by NCBI; license required xmllint: open source $ xmllint --schema ~/bin/TraceAssembly.xsd umd-*/ASSEMBLY.xml > /dev/null umd-20070816-125223/ASSEMBLY.xml validates
4. edit files $ rm *.tar.gz $ md5sum umd-*/ASSEMBLY.xml $ edit umd-*/MANIFEST # update ASSEMBLY.xml md5sum $ ls -1 umd-* umd-20070816-125223/ 1106158952778_stitched_20070817-141849.con # Contig consensus 1106158952778_stitched_20070817-141849.congap # Contig gaps ASSEMBLY.xml # Assembly XML MANIFEST # MD5 sums
4. create tarball $ tar czvf umd-20070816-125223.tar.gz umd-20070816-125223/
5. upload tarball !!! contact trace@ncbi.nlm.nih.gov if login/password error $ ftp ftp-private.ncbi.nlm.nih.gov login: cbcb_trc passwd: t@@GeaYF
$ cd assembly $ put *.tar.gz
dbGSS
- 4 files:
1. Publication
TYPE: Pub #required MEDUID: 92347897 TITLE: #required Genomic sequences from a subtracted retinal pigment epithelium library AUTHORS: #required Gieser,L.; Swaroop,A. JOURNAL: Genomics VOLUME: 13 ISSUE: 2 PAGES: 873-6 YEAR: 1992 #required STATUS: 4 #required :1=unpublished, 2=submitted, 3=in press, 4=published ||
2. Library
TYPE: Lib #required NAME: Rat Lambda Zap Express Library ORGANISM: Rattus norvegicus STRAIN: Sprague-Dawley SEX: male STAGE: embryonic day 17 post-fertilization TISSUE: aorta CELL_TYPE: vascular smooth muscle DESCR: Put description here. ||
3. Contact
TYPE: Cont NAME: Sikela JM FAX: 303 270 7097 TEL: 303 270 EMAIL: tjs@tally.hsc.colorado.edu LAB: Department of Pharmacology INST: University of Colorado Health Sciences Center ADDR: Box C236, 4200 E. 9th Ave., Denver, CO 80262-0236, USA ||
4. GSS sequence file
TYPE: GSS STATUS: New CONT_NAME: Sikela JM GSS#: Ayh00001 CLONE: HHC189 SOURCE: ATCC SOURCE_INHOST: 65128 OTHER_GSS: GSS00093, GSS000101 CITATION: Genomic sequences from Human brain tissue SEQ_PRIMER: M13 Forward P_END: 5' HIQUAL_START: 1 HIQUAL_STOP: 285 DNA_TYPE: Genomic CLASS: shotgun LIBRARY: Hippocampus, Stratagene (cat. #936205) PUBLIC: PUT_ID: Actin, gamma, skeletal COMMENT: SEQUENCE: AATCAGCCTGCAAGCAAAAGATAGGAATATTCACCTACAGTGGGCACCTCCTTAAGAAGCTG ... ||