Pine tree
Jump to navigation
Jump to search
Links
- dendrome@ucdavis
- pinegenome.org
- NCBI Taxonomy record Pinus taeda or "loblolly pine"
- LOBLOLLY PINE BAC LIBRARY@MSSTATE.EDU
- Adventures in the enormous: a 1.8 million clone BAC library for the 21.7 Gb genome of loblolly pine. PLoS One Jan 2011
Abstract: Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).
Data
NCBI
- SRA traces BAC 454 reads
- BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266
- Plant mitochondrion finished sequences
. elem min q1 q2 q3 max mean sum len 31 45223 209482 414903 539368 982833 402851 12488404 gc% 31 32.80 43.73 43.93 44.98 46.92 43.41 .
- Cycas taitungensis has the most similar mitochondrion
NC_009618 chloroplast 163,403 NC_010303 mitochondrion 414,903 mitochondrion vs chloroplast: Cycas_taitungensis_mito-chloroplast.png
UCDAVIS plone
- Links
https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq dpuiu ddr5fft6 https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/
- Documents
- PRS_experiment_agenda_2011-07-28_05-43pm_PDT.ods 21 July 2011
IPST ftp
ftp genomepc1.umd.edu ftpuser pinegenome cd PineUpload052911/ bin prompt # no Y/N? mget *
Local data
ginkgo: /fs/szattic-asmg7/PINE/PineUpload052911 /fs/szattic-asmg7/PINE/PineUpload070711
PineUpload052911
Chloroplast
len gc% cChloroplast 120481 38.55
cBACs
. elem min q1 q2 q3 max mean n50 sum len 102 8288 89909 116121 140549 172161 113400 126689 11566806 gc% 102 34.44 36.56 37.61 38.80 52.88 37.94 37.66 3870.87
Reads
lane readLen #mates mea,std ~gc% FC638TR_001_8 146 22,729,231 400 39.04 FC638TR_002_8 146 18,412,638 400 39.04
- Quality decreases sharply after pos 120 FC638TR.qual.png
- First 10bp of each read have higher AG count FC638TR.content.png
- Over 0.5% Ns certain positions FC638TR.Ns.png
fwd: 1.015% pos=100 ; 0.81% pos=119 rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21
- GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)
- Contamination:
lane #reads #cChloroplast #cBAC #mito FC638TR_001_8_1 22,729,231 468,309(2%) 9,533,849(42.7%) 12715(0.056%) FC638TR_001_8_2 22,729,231 466,185(2%) 9,303,475(41.7%) 12291 FC638TR_002_8_1 18,412,638 995,291(5.4%) 7,535,809(41.7%) 30839 (0.16%) FC638TR_002_8_2 18,412,638 990,122(5.4%) 7,330,078(40.5%) 29444 total 85289 # ~21X cvg for 100bp read len & 400K mito genome
- alignments:
program: bwa bwasw cChloroplast ref: 1 seq cBAC: 101 seqs mito: 83 scaffolds ~358162bp
SOAPdenovo's
#scaffold stats . elem min q1 q2 q3 max mean n50 sum -K31 -d0 -max_rd_len100 13,747,338 100 100 100 100 9,185 108.04 . 1,485,269,562 -K31 -d2 -max_rd_len72 28,934 100 111 136 426 23,376 378.53* 0 10,952,507 -K31 -d2 -max_rd_len100 74,820 100 105 125 390 31,673 320.75 . 23,998,536 -K31 -d2 -max_rd_len146 264,547 100 108 123 169 32,435 228.49 0 60,445,493
-K31 -d20 -max_rd_len100 7,859* 100 113 139 284 43,079 331.49 . 2,605,184 -K31 -d48 -max_rd_len100 3,626 100 113 139 255 43,131* 339.01 . 1,229,250
-K47 -d0 -max_rd_len100 211,820 100 143 156* 187 23,273 227.95 . 48,284,629 -K47 -d2 -max_rd_len100 61,152 100 121 151 200 30,846 286.05 0 17,492,450
SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100
#stats . elem min q1 q2 q3 max mean n50 sum readOnContig scf 74,820 100 105 125 390 31,673 320.75 0 23,998,536 ctg 5,755,282 32 32 35 43 7,195 41.63 0 239,620,204 33,083,609(40%) edge 11,015,468 1 2 4 11 7,164 8.75 0 96,380,983 reads 82,283,738 6,006,712,874
#scf alignments . elem min q1 q2 q3 max mean n50 sum all 74,820 100 105 125 390 31,673 320.75 0 23,998,536 cChloroplast 206 100 122 159 229 767 191.56 0 39,462 # VERY BAD cBAC 10,533 100 113 143 428 26,589 477.68 0 5,031,439 mito 83 105 448 1730 6851 26,364 4315.20 0 358,162 other 63,998 100 104 122 382 31,673 290.16 0 18,569,473 # align to mito database ; Cycas_taitungensis was top hit other.long.hiGC 45 5066 6717 8233 10488 31,673 9662.07 0 434,793
SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100
#stats . elem min q1 q2 q3 max mean n50 sum readOnContig scf 7,859 100 113 139 284 43,079* 331.49 . 2,605,184 ctg 200,062 32 33 37 47 10,392 48.52 . 9,707,307 19,002,331(23%) reads 82,283,738
#scf alignments . elem min q1 q2 q3 max mean n50 sum all 7,859* 100 113 139 284 43,079* 331.49 . 2,605,184 cChloroplast 20 111 193 436 6140 43,079 5951.05 0 119,021 # MUCH BETTER cBAC 5,117 100 114 141 320 13,733 334.94 0 1,713,870 mito 8 101 134 685 1396 2,166 749.75 0 5,998 # VERY BAD other 2,714 100 111 133 226 7,353 282.35 0 766,295
SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads
#scaffold stats . elem min q1 q2 q3 max mean n50 sum scf 20 111 193 436 6140 42707 5928.20 0 118564
PineUpload070711
Ecoli
len gc% cE_coli 4639675 50.79
Cloning vector
len gc% pFosDT5_2 8345 47.93
Drosophila refseq
Chromosome len gc% 2L 23,011,544 41 2R 21,146,708 43 3L 24,543,557 41 3R 27,905,053 42 4 1,351,857 35 X 22,422,827 42 un 10,049,037 ? mitochondrion 19,517 17 total 137,586,636 ? # actually the chromosome lengths sum to 130,450,100
Reads
lib readLen #reads #cE_coli #pFosDT5_2 #cChloroplast #cBAC FC70M6V_6_001_1 160 23546475 2931496(12.44%) 5473141(23.24%) 24148(0.10%) 7739576(32.86%) FC70M6V_6_001_2 156 23546475 2885406(12.25%) 5854468(24.86%) 21794(0.09%) 7520343(31.93%)
lib readLen #mates mea,std ~gc% %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other FC70M6V_6_001 160,156 23546475 343,30 42.5 12.5% 24% 0.09% 32.5 19.3 # sampled 100K TIL_242_FC70M6V_2_002 160,156 9917211 242 . 91.4% TIL_242_FC70M6V_3_002 160,156 6276300 242 92.7% TIL_254_FC70M6V_2_004 160,156 9279789 254 . 91.5% TIL_254_FC70M6V_3_004 160,156 5924239 254 92.9% TIL_270_FC70M6V_2_003 160,156 10188776 270 . 88.1% TIL_270_FC70M6V_3_003 160,156 6556676 270 90.3% TIL_288_FC70M6V_2_001 160,156 9524524 288 . 80.0% TIL_288_FC70M6V_3_001 160,156 6158919 288 83.0%
- kastevens@ucdavis.edu:
- The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
- Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
- Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
- The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
- The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
- However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
- Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
- The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
- Drosophila libraries run in lane 2 at nominal density.
- About 8.5% of the reads contain a high copy kmer . they don't get assembles
AAAGAGTGTAGATCTCGGTGGT AACTCCAGTCACTTAGGCATCT AAGACGGCATACGAGATGCCTA AAGAGTGTAGATCTCGGTGGTC AAGATCGGAAGAGCGTCGTGTA AAGCAGAAGACGGCATACGAGA AAGTGACTGGAGTTCAGACGTG ACACGTCTGAACTCCAGTCACT ACCGAGATCTACACTCTTTCCC ACGAGATGCCTAAGTGACTGGA ACGGCATACGAGATGCCTAAGT ACGGCGACCACCGAGATCTACA ACGTCTGAACTCCAGTCACTTA ACTCCAGTCACTTAGGCATCTC AGAAGACGGCATACGAGATGCC AGACGGCATACGAGATGCCTAA AGACGTGTGCTCTTCCGATCTA AGAGTGTAGATCTCGGTGGTCG AGATCGGAAGAGCACACGTCTG AGATCGGAAGAGCGTCGTGTAG
SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100
#stats . elem min q1 q2 q3 max mean n50 sum readOnContig scf 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707 ctg 802,463 32 33 39 63 73,415 91.13 0 73,131,767 37,254,577 edge 1,013,801 1 2 7 32 30,919 48.85 0 49,525,815 reads 47,092,950 7,440,686,100
#scf alignments . elem min q1 q2 q3 max mean n50 sum all 20,441 100 124 374 1980 291,000 2575.50 0 52,645,707 cE_coli 149 100 325 6612 41908 291,000 30160.59 0 4,493,928 cpFosDT5_2 0 cChloroplast 58 105 166 374 1950 24,932 1875.86 0 108,800 cBAC 12,294 100 141 785 4204 45,781 3513.34 0 43,192,987 other 7953 100 113 171 599 41,416 619.60 0 4,927,664
SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100
#stats . elem min q1 q2 q3 max mean n50 sum readOnContig scf 25,482 100 127 262 993 239,672 1339.89 0 34,143,040 ctg 265,450 32 34 50 121 49,599 143.69 0 38,141,459 40,191,864(85%) edge 530,926 1 3 11 40 41,918 63.06 0 33,477,999 reads 47,092,950 7,440,686,100
#scf alignments . elem min q1 q2 q3 max mean n50 sum all 25,482 100 127 262 993 239,672 1339.89 0 34,143,040 cE_coli 205 100 252 2244 30571 239,672 21916.78 0 4,492,939 cpFosDT5_2 17 100 118 171 272 855 275.24 0 4,679 cChloroplast 31 100 130 322 1363 5,717 986.52 0 30,582 cBAC 15,668 100 133 336 1529 33,075 1559.92 0 24,440,863 other 9,574 100 117 171 522 27,341 542.74 0 5,196,233