Pine tree: Difference between revisions

From Cbcb
Jump to navigation Jump to search
 
(11 intermediate revisions by the same user not shown)
Line 92: Line 92:
== SOAPdenovo's ==
== SOAPdenovo's ==
   #scaffold stats
   #scaffold stats
   .                                elem       min    q1    q2    q3    max        mean      n50        sum  
   .                                elem       min    q1    q2    q3    max        mean      n50        sum  
   -K31 -d0  -max_rd_len100        13747338  100    100    100    100    9185      108.04    .          1,485,269,562
   -K31 -d0  -max_rd_len100        13,747,338  100    100    100    100    9,185      108.04    .          1,485,269,562
   
   
   -K31 -d2  -max_rd_len72  
   -K31 -d2  -max_rd_len72         28,934      100    111    136    426    23,376    378.53*    0          10,952,507
   -K31 -d2  -max_rd_len100        74820     100    105    125    390    31673      320.75    .          23,998,536   
   -K31 -d2  -max_rd_len100        74,820     100    105    125    390    31,673    320.75    .          23,998,536   
   -K31 -d2  -max_rd_len146        224963     100    110   128   343   23410      260.64     .         58,635,190
   -K31 -d2  -max_rd_len146        264,547     100    108   123   169   32,435    228.49     0         60,445,493


   -K31 -d20 -max_rd_len100        7859*      100    113    139    284    43079      331.49    .          2,605,184             
   -K31 -d20 -max_rd_len100        7,859*      100    113    139    284    43,079    331.49    .          2,605,184             
   -K31 -d48 -max_rd_len100        3626       100    113    139    255    43131      339.01    .          1,229,250
   -K31 -d48 -max_rd_len100        3,626       100    113    139    255    43,131*    339.01    .          1,229,250


   -K47 -d0  -max_rd_len100        211820     100    143    156*  187    23273      227.95    .          48,284,629
   -K47 -d0  -max_rd_len100        211,820     100    143    156*  187    23,273    227.95    .          48,284,629
   -K47 -d2  -max_rd_len100
   -K47 -d2  -max_rd_len100         61,152      100    121    151    200    30,846    286.05    0          17,492,450


==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
==  SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
   #stats
   #stats
   .              elem     min  q1  q2    q3    max    mean    n50  sum
   .              elem       min  q1  q2    q3    max    mean    n50  sum           readOnContig
   scf            74820    100  105  125  390  31673  320.75  0    23998536
   scf            74,820      100  105  125  390  31,673 320.75  0    23,998,536
   ctg            5755282   32  32  35    43    7195  41.63    0    239620204
   ctg            5,755,282   32  32  35    43    7,195  41.63    0    239,620,204  33,083,609(40%)
   edge            11015468 1    2    4    11    7164  8.75    0    96380983
   edge            11,015,468 1    2    4    11    7,164  8.75    0    96,380,983
  reads          82,283,738                                            6,006,712,874


   #scf alignments
   #scf alignments
   .              elem      min  q1  q2    q3    max   mean    n50  sum
   .              elem      min  q1  q2    q3    max     mean    n50  sum
   all            74820    100  105  125  390  31673 320.75  0    23998536
   all            74,820    100  105  125  390  31,673 320.75  0    23,998,536
   cChloroplast    206      100  122  159  229  767   191.56  0    39462      # VERY BAD
   cChloroplast    206      100  122  159  229  767     191.56  0    39,462      # VERY BAD
   cBAC            10533    100  113  143  428  26589 477.68  0    5031439
   cBAC            10,533    100  113  143  428  26,589 477.68  0    5,031,439
   mito            83        105  448  1730  6851  26364 4315.20  0    358162
   mito            83        105  448  1730  6851  26,364 4315.20  0    358,162
   other          63998    100  104  122  382  31673 290.16  0    18569473   # align to mito database ; Cycas_taitungensis was top hit
   other          63,998    100  104  122  382  31,673 290.16  0    18,569,473   # align to mito database ; Cycas_taitungensis was top hit
   other.long.hiGC 45        5066 6717 8233  10488 31673 9662.07  0    434793
   other.long.hiGC 45        5066 6717 8233  10488 31,673 9662.07  0    434,793


== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
   #stats
   #stats
   .              elem      min  q1  q2    q3    max   mean    n50  sum
   .              elem      min  q1  q2    q3    max     mean    n50  sum         readOnContig
   scf            7859      100  113  139  284  43079* 331.49  .    2605184
   scf            7,859    100  113  139  284  43,079* 331.49  .    2,605,184
   ctg            200062    32  33  37    47    10392 48.52    .    9707307
   ctg            200,062  32  33  37    47    10,392 48.52    .    9,707,307    19,002,331(23%)
  reads          82,283,738


   #scf alignments
   #scf alignments
   .              elem      min  q1  q2    q3    max   mean    n50  sum
   .              elem      min  q1  q2    q3    max     mean    n50  sum
   all            7859*     100  113  139  284  43079* 331.49  .    2605184
   all            7,859*   100  113  139  284  43,079* 331.49  .    2,605,184
   cChloroplast    20        111  193  436  6140  43079 5951.05  0    119021
   cChloroplast    20        111  193  436  6140  43,079 5951.05  0    119,021      # MUCH BETTER
   cBAC            5117      100  114  141  320  13733 334.94  0    1713870
   cBAC            5,117    100  114  141  320  13,733 334.94  0    1,713,870
   mito            8        101  134  685  1396  2166   749.75  0    5998       # VERY BAD
   mito            8        101  134  685  1396  2,166   749.75  0    5,998       # VERY BAD
   other          2714      100  111  133  226  7353   282.35  0    766295
   other          2,714    100  111  133  226  7,353   282.35  0    766,295


== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
== SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads==
Line 164: Line 166:
   total          137,586,636    ?    # actually the chromosome lengths sum to 130,450,100
   total          137,586,636    ?    # actually the chromosome lengths sum to 130,450,100


== Reads (Drosophila) ==     
== Reads ==     


   lib                      readLen  #reads    #cE_coli        #pFosDT5_2      #cChloroplast  #cBAC   
   lib                      readLen  #reads    #cE_coli        #pFosDT5_2      #cChloroplast  #cBAC   
Line 170: Line 172:
   FC70M6V_6_001_2          156      23546475  2885406(12.25%)  5854468(24.86%)  21794(0.09%)  7520343(31.93%)
   FC70M6V_6_001_2          156      23546475  2885406(12.25%)  5854468(24.86%)  21794(0.09%)  7520343(31.93%)


   lib                      readLen  #mates    mea,std  ~gc%  %merged(Tanja)   %cE_coli %cpFosDT5_2  %cChloroplast %cBAC  %other   
   lib                      readLen  #mates    mea,std  ~gc%  %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro %cBAC %pBAC-DE %other   
   FC70M6V_6_001            160,156  23546475  343,30    42.5                   12.5%     24%         0.09%         32.5   34      # sampled 100K
   FC70M6V_6_001            160,156  23546475  343,30    42.5                 12.5%   24%         0.09%     32.5   19.3          # sampled 100K
   
   
   TIL_242_FC70M6V_2_002    160,156  9917211  242      .      91.4%   
   TIL_242_FC70M6V_2_002    160,156  9917211  242      .      91.4%   
Line 184: Line 186:
   TIL_288_FC70M6V_2_001    160,156  9524524  288        .    80.0%
   TIL_288_FC70M6V_2_001    160,156  9524524  288        .    80.0%
   TIL_288_FC70M6V_3_001    160,156  6158919  288              83.0%
   TIL_288_FC70M6V_3_001    160,156  6158919  288              83.0%


* kastevens@ucdavis.edu:
* kastevens@ucdavis.edu:
Line 196: Line 197:
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the  
** The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the  
** Drosophila libraries run in lane 2 at nominal density.
** Drosophila libraries run in lane 2 at nominal density.
* About 8.5% of the reads contain a high copy kmer . they don't get assembles
AAAGAGTGTAGATCTCGGTGGT
AACTCCAGTCACTTAGGCATCT
AAGACGGCATACGAGATGCCTA
AAGAGTGTAGATCTCGGTGGTC
AAGATCGGAAGAGCGTCGTGTA
AAGCAGAAGACGGCATACGAGA
AAGTGACTGGAGTTCAGACGTG
ACACGTCTGAACTCCAGTCACT
ACCGAGATCTACACTCTTTCCC
ACGAGATGCCTAAGTGACTGGA
ACGGCATACGAGATGCCTAAGT
ACGGCGACCACCGAGATCTACA
ACGTCTGAACTCCAGTCACTTA
ACTCCAGTCACTTAGGCATCTC
AGAAGACGGCATACGAGATGCC
AGACGGCATACGAGATGCCTAA
AGACGTGTGCTCTTCCGATCTA
AGAGTGTAGATCTCGGTGGTCG
AGATCGGAAGAGCACACGTCTG
AGATCGGAAGAGCGTCGTGTAG


== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
== SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100 ==
   #stats
   #stats
   .              elem     min  q1  q2    q3    max     mean      n50  sum
   .              elem     min  q1  q2    q3    max     mean      n50  sum               readOnContig
   scf            20441   100  124  374  1980  291000 2575.50  0    52645707
   scf            20,441   100  124  374  1980  291,000 2575.50  0    52,645,707
   ctg            802463   32  33  39    63    73415   91.13    0    73131767
   ctg            802,463   32  33  39    63    73,415   91.13    0    73,131,767        37,254,577
   edge            1013801  1    2    7    32    30919   48.85    0    49525815
   edge            1,013,801 1    2    7    32    30,919   48.85    0    49,525,815
  reads          47,092,950                                              7,440,686,100
 
   #scf alignments
   #scf alignments
   .              elem     min  q1  q2    q3    max     mean      n50  sum
   .              elem     min  q1  q2    q3    max     mean      n50  sum
   all            20441   100  124  374  1980  291000 2575.50  0    52645707
   all            20,441   100  124  374  1980  291,000 2575.50  0    52,645,707
   cE_coli        149     100  325  6612  41908  291000 30160.59  0    4493928
   cE_coli        149       100  325  6612  41908  291,000 30160.59  0    4,493,928
   cpFosDT5_2      0
   cpFosDT5_2      0
   cChloroplast    58       105  166  374  1950  24932   1875.86  0    108800
   cChloroplast    58       105  166  374  1950  24,932   1875.86  0    108,800
   cBAC            12294   100  141  785  4204  45781   3513.34  0    43192987
   cBAC            12,294   100  141  785  4204  45,781   3513.34  0    43,192,987
   other          7953     100  113  171  599    41416   619.60    0    4927664
   other          7953     100  113  171  599    41,416   619.60    0    4,927,664


== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
== SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100 ==
   #stats
   #stats
   .              elem   min  q1  q2    q3    max     mean      n50  sum
   .              elem     min  q1  q2    q3    max     mean      n50  sum               readOnContig
   scf            25482  100  127  262  993    239672 1339.89  0    34143040
   scf            25,482    100  127  262  993    239,672 1339.89  0    34,143,040
   ctg            265450  32  34  50    121    49599   143.69    0    38141459
   ctg            265,450  32  34  50    121    49,599   143.69    0    38,141,459        40,191,864(85%)
   edge            530926  1    3    11    40    41918   63.06    0    33477999
   edge            530,926  1    3    11    40    41,918   63.06    0    33,477,999
  reads          47,092,950                                              7,440,686,100
 
   #scf alignments
   #scf alignments
   .              elem   min  q1  q2    q3    max     mean      n50  sum
   .              elem     min  q1  q2    q3    max     mean      n50  sum
   all            25482  100  127  262  993    239672 1339.89  0    34143040
   all            25,482    100  127  262  993    239,672 1339.89  0    34,143,040
   cE_coli        205     100  252  2244  30571  239672 21916.78  0    4492939
   cE_coli        205       100  252  2244  30571  239,672 21916.78  0    4,492,939
   cpFosDT5_2      17     100  118  171  272    855     275.24    0    4679
   cpFosDT5_2      17       100  118  171  272    855     275.24    0    4,679
   cChloroplast    31     100  130  322  1363  5717   986.52    0    30582
   cChloroplast    31       100  130  322  1363  5,717   986.52    0    30,582
   cBAC            15668  100  133  336  1529  33075   1559.92  0    24440863
   cBAC            15,668    100  133  336  1529  33,075   1559.92  0    24,440,863
   other          9574    100  117  171  522    27341   542.74    0    5196233
   other          9,574    100  117  171  522    27,341   542.74    0    5,196,233

Latest revision as of 21:35, 11 August 2011

Links

Abstract: Loblolly pine (LP; Pinus taeda L.) is the most economically important tree in the U.S. and a cornerstone species in southeastern forests. However, genomics research on LP and other conifers has lagged behind studies on flowering plants due, in part, to the large size of conifer genomes. As a means to accelerate conifer genome research, we constructed a BAC library for the LP genotype 7-56. The LP BAC library consists of 1,824,768 individually-archived clones making it the largest single BAC library constructed to date, has a mean insert size of 96 kb, and affords 7.6X coverage of the 21.7 Gb LP genome. To demonstrate the efficacy of the library in gene isolation, we screened macroarrays with overgos designed from a pine EST anchored on LP chromosome 10. A positive BAC was sequenced and found to contain the expected full-length target gene, several gene-like regions, and both known and novel repeats. Macroarray analysis using the retrotransposon IFG-7 (the most abundant repeat in the sequenced BAC) as a probe indicates that IFG-7 is found in roughly 210,557 copies and constitutes about 5.8% or 1.26 Gb of LP nuclear DNA; this DNA quantity is eight times the Arabidopsis genome. In addition to its use in genome characterization and gene isolation as demonstrated herein, the BAC library should hasten whole genome sequencing of LP via next-generation sequencing strategies/technologies and facilitate improvement of trees through molecular breeding and genetic engineering. The library and associated products are distributed by the Clemson University Genomics Institute (www.genome.clemson.edu).

Data

NCBI

  • BAC assembled sequences : AC241263..AC241361, HQ141589, GU477256..GU477266
  • Plant mitochondrion finished sequences
 .      elem    min    q1      q2      q3      max      mean     sum
 len    31      45223  209482  414903  539368  982833   402851   12488404
 gc%    31      32.80  43.73   43.93   44.98   46.92    43.41    .
  • Cycas taitungensis has the most similar mitochondrion
 NC_009618	chloroplast     163,403
 NC_010303	mitochondrion   414,903
 mitochondrion vs chloroplast:  Cycas_taitungensis_mito-chloroplast.png

UCDAVIS plone

  • Links
 https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq  
 dpuiu
 ddr5fft6 
 https://dendrome.ucdavis.edu/TGPlone/research-projects/pinerefseq/files/library-and-flow-cell-data/prs-tracking-database-archive/

IPST ftp

 ftp genomepc1.umd.edu
 ftpuser
 pinegenome

 cd PineUpload052911/
 bin
 prompt             # no Y/N?
 mget *

Local data

 ginkgo:
 /fs/szattic-asmg7/PINE/PineUpload052911
 /fs/szattic-asmg7/PINE/PineUpload070711

PineUpload052911

Chloroplast

                len      gc%
 cChloroplast   120481   38.55

cBACs

 .       elem       min    q1     q2     q3     max        mean       n50        sum            
 len     102        8288   89909  116121 140549 172161     113400     126689     11566806       
 gc%     102        34.44  36.56  37.61  38.80  52.88      37.94      37.66      3870.87        

Reads

 lane           readLen   #mates        mea,std      ~gc%
 FC638TR_001_8  146       22,729,231    400           39.04
 FC638TR_002_8  146       18,412,638    400           39.04
 fwd: 1.015% pos=100 ; 0.81% pos=119
 rev: 1.114% pos=101 ; 0.92% pos=107 ; 0.87% pos=30; 0.21% pos 21
  • GC% variation: cBAC(37.5%) < cChloroplast(38.5%) < reads(39%) < mito (44%+)
  • Contamination:
 lane                   #reads       #cChloroplast   #cBAC               #mito
 FC638TR_001_8_1	22,729,231   468,309(2%)     9,533,849(42.7%)    12715(0.056%)
 FC638TR_001_8_2	22,729,231   466,185(2%)     9,303,475(41.7%)    12291
 FC638TR_002_8_1	18,412,638   995,291(5.4%)   7,535,809(41.7%)    30839 (0.16%) 
 FC638TR_002_8_2	18,412,638   990,122(5.4%)   7,330,078(40.5%)    29444
 total                                                                   85289             # ~21X cvg for 100bp read len & 400K mito genome
  • alignments:
 program: bwa bwasw
 cChloroplast ref: 1 seq
 cBAC:             101 seqs
 mito:             83 scaffolds ~358162bp

SOAPdenovo's

 #scaffold stats
 .                                elem        min    q1     q2     q3     max        mean       n50        sum 
 -K31 -d0  -max_rd_len100         13,747,338  100    100    100    100    9,185      108.04     .          1,485,269,562

 -K31 -d2  -max_rd_len72          28,934      100    111    136    426    23,376     378.53*    0          10,952,507
 -K31 -d2  -max_rd_len100         74,820      100    105    125    390    31,673     320.75     .          23,998,536  
 -K31 -d2  -max_rd_len146         264,547     100    108    123    169    32,435     228.49     0          60,445,493
 -K31 -d20 -max_rd_len100         7,859*      100    113    139    284    43,079     331.49     .          2,605,184            
 -K31 -d48 -max_rd_len100         3,626       100    113    139    255    43,131*    339.01     .          1,229,250
 -K47 -d0  -max_rd_len100         211,820     100    143    156*   187    23,273     227.95     .          48,284,629
 -K47 -d2  -max_rd_len100         61,152      100    121    151    200    30,846     286.05     0          17,492,450

SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100

 #stats
 .               elem        min  q1   q2    q3    max    mean     n50  sum           readOnContig
 scf             74,820      100  105  125   390   31,673 320.75   0    23,998,536
 ctg             5,755,282   32   32   35    43    7,195  41.63    0    239,620,204   33,083,609(40%)
 edge            11,015,468  1    2    4     11    7,164  8.75     0    96,380,983
 reads           82,283,738                                             6,006,712,874
 #scf alignments
 .               elem      min  q1   q2    q3    max     mean     n50  sum
 all             74,820    100  105  125   390   31,673  320.75   0    23,998,536
 cChloroplast    206       100  122  159   229   767     191.56   0    39,462       # VERY BAD
 cBAC            10,533    100  113  143   428   26,589  477.68   0    5,031,439
 mito            83        105  448  1730  6851  26,364  4315.20  0    358,162
 other           63,998    100  104  122   382   31,673  290.16   0    18,569,473   # align to mito database ; Cycas_taitungensis was top hit
 other.long.hiGC 45        5066 6717 8233  10488 31,673  9662.07  0    434,793

SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100

 #stats
 .               elem      min  q1   q2    q3    max     mean     n50  sum          readOnContig
 scf             7,859     100  113  139   284   43,079* 331.49   .    2,605,184
 ctg             200,062   32   33   37    47    10,392  48.52    .    9,707,307    19,002,331(23%)
 reads           82,283,738
 #scf alignments
 .               elem      min  q1   q2    q3    max     mean     n50  sum
 all             7,859*    100  113  139   284   43,079* 331.49   .    2,605,184
 cChloroplast    20        111  193  436   6140  43,079  5951.05  0    119,021      # MUCH BETTER
 cBAC            5,117     100  114  141   320   13,733  334.94   0    1,713,870
 mito            8         101  134  685   1396  2,166   749.75   0    5,998        # VERY BAD
 other           2,714     100  111  133   226   7,353   282.35   0    766,295

SOAPdenovo-31mer -K 31 -d 48 -max_rd_len 100 choloplast_mated_reads

 #scaffold stats
 .               elem      min  q1   q2    q3    max    mean     n50  sum            
 scf             20        111  193  436   6140  42707  5928.20  0    118564

PineUpload070711

Ecoli

                len     gc%
 cE_coli        4639675 50.79  

Cloning vector

                len    gc% 
 pFosDT5_2      8345   47.93

Drosophila refseq

 Chromosome      len            gc%
 2L              23,011,544     41
 2R              21,146,708     43
 3L              24,543,557     41
 3R              27,905,053     42
 4               1,351,857      35
 X               22,422,827     42 
 un              10,049,037     ?    
 mitochondrion   19,517         17
 total           137,586,636    ?     # actually the chromosome lengths sum to 130,450,100

Reads

 lib                      readLen  #reads    #cE_coli         #pFosDT5_2       #cChloroplast  #cBAC  
 FC70M6V_6_001_1          160      23546475  2931496(12.44%)  5473141(23.24%)  24148(0.10%)   7739576(32.86%)
 FC70M6V_6_001_2          156      23546475  2885406(12.25%)  5854468(24.86%)  21794(0.09%)   7520343(31.93%)
 lib                      readLen  #mates    mea,std   ~gc%  %merged(Tanja) %cE_coli %cpFosDT5_2 %cChloro  %cBAC  %pBAC-DE %other  
 FC70M6V_6_001            160,156  23546475  343,30    42.5                 12.5%    24%         0.09%     32.5   19.3          # sampled 100K

 TIL_242_FC70M6V_2_002    160,156  9917211   242       .      91.4%  
 TIL_242_FC70M6V_3_002    160,156  6276300   242              92.7%  

 TIL_254_FC70M6V_2_004    160,156  9279789   254        .     91.5%
 TIL_254_FC70M6V_3_004    160,156  5924239   254              92.9%

 TIL_270_FC70M6V_2_003    160,156  10188776  270        .     88.1%
 TIL_270_FC70M6V_3_003    160,156  6556676   270              90.3%

 TIL_288_FC70M6V_2_001    160,156  9524524   288        .     80.0%
 TIL_288_FC70M6V_3_001    160,156  6158919   288              83.0%
  • kastevens@ucdavis.edu:
    • The files labeled TIL_XXX_FC70M6V_Y_00Z, are Drosophila libraries with a median target insert size of XXX. They come in pairs and can be merged.
    • Regarding pairing, each insert size was run in two lanes Y at two different concentrations.
    • Lane 3, with the lower concentration, should have higher quality data than lane 2 but with a higher cost per bp.
    • The loss in quality was quantitativly small, so we don't expect the extra expense of lowering the concentration will be justified empirically.
    • The first library, FC70M6V_6_001, is a ~40x library created from a pool of ~1000 fosmids. In general, we do not put the insert size in the filename.
    • However, we did estimate the insert size to be 343bp with a below median standard deviation of 30. So roughly 15% of the inserts are < 313bp and have > 3bp overlap. This seems to fit well with your result.
    • Each lane is multiplexed into sub-lanes indicated by 00Z. So the amount of reads in the file is variable and not nessesarily reflective of the cluster density.
    • The Drosophila libraries were each run in 1/4 lane and the fosmid pool was run in 1/2 lane. The pool has roughy double the sequence content of the
    • Drosophila libraries run in lane 2 at nominal density.
  • About 8.5% of the reads contain a high copy kmer . they don't get assembles
AAAGAGTGTAGATCTCGGTGGT
AACTCCAGTCACTTAGGCATCT
AAGACGGCATACGAGATGCCTA
AAGAGTGTAGATCTCGGTGGTC
AAGATCGGAAGAGCGTCGTGTA
AAGCAGAAGACGGCATACGAGA
AAGTGACTGGAGTTCAGACGTG
ACACGTCTGAACTCCAGTCACT
ACCGAGATCTACACTCTTTCCC
ACGAGATGCCTAAGTGACTGGA
ACGGCATACGAGATGCCTAAGT
ACGGCGACCACCGAGATCTACA
ACGTCTGAACTCCAGTCACTTA
ACTCCAGTCACTTAGGCATCTC
AGAAGACGGCATACGAGATGCC
AGACGGCATACGAGATGCCTAA
AGACGTGTGCTCTTCCGATCTA
AGAGTGTAGATCTCGGTGGTCG
AGATCGGAAGAGCACACGTCTG
AGATCGGAAGAGCGTCGTGTAG

SOAPdenovo-31mer -K 31 -d 2 -max_rd_len 100

 #stats
 .               elem      min  q1   q2    q3     max      mean      n50  sum               readOnContig
 scf             20,441    100  124  374   1980   291,000  2575.50   0    52,645,707
 ctg             802,463   32   33   39    63     73,415   91.13     0    73,131,767        37,254,577
 edge            1,013,801 1    2    7     32     30,919   48.85     0    49,525,815
 reads           47,092,950                                               7,440,686,100
 #scf alignments
 .               elem      min  q1   q2    q3     max      mean      n50  sum
 all             20,441    100  124  374   1980   291,000  2575.50   0    52,645,707
 cE_coli         149       100  325  6612  41908  291,000  30160.59  0    4,493,928
 cpFosDT5_2      0
 cChloroplast    58        105  166  374   1950   24,932   1875.86   0    108,800
 cBAC            12,294    100  141  785   4204   45,781   3513.34   0    43,192,987
 other           7953      100  113  171   599    41,416   619.60    0    4,927,664

SOAPdenovo-31mer -K 31 -d 20 -max_rd_len 100

 #stats
 .               elem      min  q1   q2    q3     max      mean      n50  sum               readOnContig
 scf             25,482    100  127  262   993    239,672  1339.89   0    34,143,040
 ctg             265,450   32   34   50    121    49,599   143.69    0    38,141,459        40,191,864(85%)
 edge            530,926   1    3    11    40     41,918   63.06     0    33,477,999
 reads           47,092,950                                               7,440,686,100
 #scf alignments
 .               elem      min  q1   q2    q3     max      mean      n50  sum
 all             25,482    100  127  262   993    239,672  1339.89   0    34,143,040
 cE_coli         205       100  252  2244  30571  239,672  21916.78  0    4,492,939
 cpFosDT5_2      17        100  118  171   272    855      275.24    0    4,679
 cChloroplast    31        100  130  322   1363   5,717    986.52    0    30,582
 cBAC            15,668    100  133  336   1529   33,075   1559.92   0    24,440,863
 other           9,574     100  117  171   522    27,341   542.74    0    5,196,233